MD04G1087800.v1.1
ERF Family

Belongs to the TRAFAC class myosin-kinesin ATPase superfamily. Kinesin family

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr04
Physical Location & Seq
Reverse (-)
13049807 .. 13060189
10383 bp
Loading structure...
UTR
Exon/CDS
Intron
MD04G1087800.v1.1.491

Sequence Viewer

Length: 264 bp
ATGAATGAAGTCAATCAAGAAATTATAATGCAAGAATGTGGGATTAGTTTGTTAACAACGACAGCCGCTGAAGCTGATGATGCTCAAACCCTATGCATGATTGCTGGAGCTATTGCTAATTTATGCGGCAATGATAAGCTACAAATGAAGCTAAGGTCTGAAGGTGGTATTAAGGCGTTGCTAGGAATTGTGAGGTGTGGGAATCCTGATGTTCTTTCCCAAGTGGCACGTGGAATAGCTAACTTTGCAAAATGTGAATCATGA

Protein Analysis

88

Amino Acids

9.16

Weight (kDa)

4.69

Isoelectric Point (pI)

25.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 26
AciI CCGC 2 cut(s) 66, 126
AcuI CTGAAG 2 cut(s) 90, 180
AcvI CACGTG 1 cut(s) 230
AluBI AGCT 5 cut(s) 74, 110, 139, 151, 239
AluI AGCT 5 cut(s) 74, 110, 139, 151, 239
AlwNI CAGNNNCTG 1 cut(s) 68
BbrPI CACGTG 1 cut(s) 230
BfaI CTAG 1 cut(s) 182
BisI GCNGC 2 cut(s) 66, 127
BlsI GCNGC 2 cut(s) 67, 128
BmsI GCATC 1 cut(s) 70
BpmI CTGGAG 1 cut(s) 126
Bpu10I CCTNAGC 1 cut(s) 152
BsaAI YACGTR 1 cut(s) 230
Bse3DI GCAATG 1 cut(s) 136
BseMI GCAATG 1 cut(s) 136
BspACI CCGC 2 cut(s) 66, 126
BspHI TCATGA 1 cut(s) 260
BsrDI GCAATG 1 cut(s) 136
BstBAI YACGTR 1 cut(s) 230
BstDEI CTNAG 1 cut(s) 152
BstMWI GCNNNNNNNGC 3 cut(s) 71, 80, 245
CaiI CAGNNNCTG 1 cut(s) 68
CciI TCATGA 1 cut(s) 260
CviAII CATG 2 cut(s) 97, 261
CviJI RGCY 6 cut(s) 65, 74, 110, 139, 151, 239
CviKI_1 RGCY 6 cut(s) 65, 74, 110, 139, 151, 239
DdeI CTNAG 1 cut(s) 152
Eco57I CTGAAG 2 cut(s) 90, 180
Eco72I CACGTG 1 cut(s) 230
EcoT22I ATGCAT 1 cut(s) 98
FaeI CATG 2 cut(s) 100, 264
FaiI YATR 5 cut(s) 26, 94, 98, 124, 262
FatI CATG 2 cut(s) 96, 260
Fnu4HI GCNGC 2 cut(s) 66, 127
Fsp4HI GCNGC 2 cut(s) 66, 127
FspBI CTAG 1 cut(s) 182
GluI GCNGC 2 cut(s) 66, 127
GsuI CTGGAG 1 cut(s) 126
Hin1II CATG 2 cut(s) 100, 264
HincII GTYRAC 1 cut(s) 54
HindII GTYRAC 1 cut(s) 54
HinfI GANTC 2 cut(s) 202, 257
HpaI GTTAAC 1 cut(s) 54
Hpy166II GTNNAC 1 cut(s) 54
Hpy188I TCNGA 1 cut(s) 160
Hpy188III TCNNGA 3 cut(s) 17, 206, 261
Hpy8I GTNNAC 1 cut(s) 54
HpyAV CCTTC 1 cut(s) 155
HpyCH4IV ACGT 1 cut(s) 229
HpyCH4V TGCA 3 cut(s) 31, 96, 248
HpyF10VI GCNNNNNNNGC 3 cut(s) 71, 80, 245
HpyF3I CTNAG 1 cut(s) 152
HpySE526I ACGT 1 cut(s) 229
Hsp92II CATG 2 cut(s) 100, 264
KspAI GTTAAC 1 cut(s) 54
LmnI GCTCC 1 cut(s) 107
LpnPI CCDG 2 cut(s) 90, 219
LweI GCATC 1 cut(s) 70
MaeI CTAG 1 cut(s) 182
MaeII ACGT 1 cut(s) 229
MluCI AATT 3 cut(s) 21, 118, 186
MnlI CCTC 1 cut(s) 186
Mph1103I ATGCAT 1 cut(s) 98
MseI TTAA 2 cut(s) 53, 171
MspA1I CMGCKG 1 cut(s) 68
MwoI GCNNNNNNNGC 3 cut(s) 71, 80, 245
NlaIII CATG 2 cut(s) 100, 264
NsiI ATGCAT 1 cut(s) 98
PagI TCATGA 1 cut(s) 260
PfeI GAWTC 2 cut(s) 202, 257
PkrI GCNGC 2 cut(s) 67, 128
PmaCI CACGTG 1 cut(s) 230
PmlI CACGTG 1 cut(s) 230
Ppu21I YACGTR 1 cut(s) 230
PsiI TTATAA 1 cut(s) 26
PspCI CACGTG 1 cut(s) 230
PstNI CAGNNNCTG 1 cut(s) 68
SaqAI TTAA 2 cut(s) 53, 171
SatI GCNGC 2 cut(s) 66, 127
SetI ASST 9 cut(s) 76, 112, 141, 153, 158, 166, 197, 232, 241
SfaNI GCATC 1 cut(s) 70
SgeI CNNG 9 cut(s) 29, 44, 109, 117, 194, 218, 233, 240, 242
Sse9I AATT 3 cut(s) 21, 118, 186
SsiI CCGC 2 cut(s) 66, 126
SspMI CTAG 1 cut(s) 182
TaiI ACGT 1 cut(s) 232
TasI AATT 3 cut(s) 21, 118, 186
TauI GCSGC 2 cut(s) 68, 129
TfiI GAWTC 2 cut(s) 202, 257
Tru1I TTAA 2 cut(s) 53, 171
Tru9I TTAA 2 cut(s) 53, 171
TspDTI ATGAA 3 cut(s) 17, 21, 161
XcmI CCANNNNNNNNNTGG 1 cut(s) 227
XspI CTAG 1 cut(s) 182
Zsp2I ATGCAT 1 cut(s) 98
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.