MD05G1113800.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr05
Physical Location & Seq
Forward (+)
23255243 .. 23255560
318 bp
Loading structure...
UTR
Exon/CDS
Intron
MD05G1113800.v1.1.491

Sequence Viewer

Length: 318 bp
ATGAAGATAAAGAACAAGGGCAAAGTCTACCCATCTCCCTCCTCCTCCTCCGACAGGTATGTTCTCTCTGTTTTTCAACTCCTCCCAGCGACTATTCTAGCTCTAGCCTCCGTGCTCTTTCTCGATGACTGCAAGGTCCTGGCTTACTTGATCACCTGCTCCATGAAAAACACCCCCGACACTTCTTCTTCAATCCCCGCCGCCCAAGACCCCCAAAAAAAGACTTCCAAGAAATGTCCTAAGAATTCCTCCAGCACCGCGGCCACCCATCAGCCTCCAATGTTCGATTGCGACCACTTTGACTGCTACAGAAGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

106

Amino Acids

11.51

Weight (kDa)

9.03

Isoelectric Point (pI)

45.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013315)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 164
AasI GACNNNNNNGTC 1 cut(s) 134
Acc36I ACCTGC 1 cut(s) 164
AccI GTMKAC 1 cut(s) 27
AccII CGCG 1 cut(s) 260
AciI CCGC 4 cut(s) 198, 201, 258, 260
AcoI YGGCCR 1 cut(s) 261
AcsI RAATTY 1 cut(s) 244
AfiI CCNNNNNNNGG 1 cut(s) 54
AgsI TTSAA 2 cut(s) 77, 192
AjnI CCWGG 1 cut(s) 138
AluBI AGCT 2 cut(s) 101, 315
AluI AGCT 2 cut(s) 101, 315
Alw21I GWGCWC 1 cut(s) 117
AoxI GGCC 1 cut(s) 261
ApoI RAATTY 1 cut(s) 244
AspS9I GGNCC 1 cut(s) 136
AsuHPI GGTGA 1 cut(s) 145
AvaII GGWCC 1 cut(s) 136
Bbv12I GWGCWC 1 cut(s) 117
BccI CCATC 2 cut(s) 40, 276
BciT130I CCWGG 1 cut(s) 140
BclI TGATCA 1 cut(s) 150
BfaI CTAG 3 cut(s) 98, 104, 316
BfmI CTRYAG 1 cut(s) 307
BfuAI ACCTGC 1 cut(s) 164
BisI GCNGC 2 cut(s) 201, 261
BlsI GCNGC 2 cut(s) 202, 262
Bme1390I CCNGG 1 cut(s) 140
Bme18I GGWCC 1 cut(s) 136
BmgT120I GGNCC 1 cut(s) 136
BmrFI CCNGG 1 cut(s) 140
BpmI CTGGAG 1 cut(s) 235
BsaJI CCNNGG 1 cut(s) 258
Bsc4I CCNNNNNNNGG 1 cut(s) 54
BseBI CCWGG 1 cut(s) 140
BseDI CCNNGG 1 cut(s) 258
BseLI CCNNNNNNNGG 1 cut(s) 54
BseRI GAGGAG 4 cut(s) 31, 34, 37, 71
BseYI CCCAGC 1 cut(s) 85
Bsh1236I CGCG 1 cut(s) 260
BshFI GGCC 1 cut(s) 263
BsiHKAI GWGCWC 1 cut(s) 117
BslI CCNNNNNNNGG 1 cut(s) 54
BsnI GGCC 1 cut(s) 263
Bsp1286I GDGCHC 1 cut(s) 117
Bsp143I GATC 1 cut(s) 150
BspACI CCGC 4 cut(s) 198, 201, 258, 260
BspANI GGCC 1 cut(s) 263
BspFNI CGCG 1 cut(s) 260
BspMI ACCTGC 1 cut(s) 164
BssECI CCNNGG 1 cut(s) 258
BssMI GATC 1 cut(s) 150
Bst2UI CCWGG 1 cut(s) 140
BstDEI CTNAG 1 cut(s) 240
BstDSI CCRYGG 1 cut(s) 258
BstENI CCTNNNNNAGG 1 cut(s) 52
BstFNI CGCG 1 cut(s) 260
BstKTI GATC 1 cut(s) 153
BstMBI GATC 1 cut(s) 150
BstMWI GCNNNNNNNGC 1 cut(s) 312
BstNI CCWGG 1 cut(s) 140
BstSCI CCNGG 1 cut(s) 138
BstSFI CTRYAG 1 cut(s) 307
BstUI CGCG 1 cut(s) 260
BsuRI GGCC 1 cut(s) 263
BtgI CCRYGG 1 cut(s) 258
BveI ACCTGC 1 cut(s) 164
Cfr13I GGNCC 1 cut(s) 136
Cfr42I CCGCGG 1 cut(s) 261
CviAII CATG 1 cut(s) 163
CviJI RGCY 6 cut(s) 101, 107, 143, 263, 274, 315
CviKI_1 RGCY 6 cut(s) 101, 107, 143, 263, 274, 315
DdeI CTNAG 1 cut(s) 240
DpnI GATC 1 cut(s) 152
DpnII GATC 1 cut(s) 150
DrdI GACNNNNNNGTC 1 cut(s) 134
DseDI GACNNNNNNGTC 1 cut(s) 134
EaeI YGGCCR 1 cut(s) 261
Eco47I GGWCC 1 cut(s) 136
EcoNI CCTNNNNNAGG 1 cut(s) 52
EcoO109I RGGNCCY 1 cut(s) 136
EcoRI GAATTC 1 cut(s) 244
EcoRII CCWGG 1 cut(s) 138
FaeI CATG 1 cut(s) 166
FaiI YATR 2 cut(s) 60, 164
FatI CATG 1 cut(s) 162
FauI CCCGC 1 cut(s) 205
FbaI TGATCA 1 cut(s) 150
FblI GTMKAC 1 cut(s) 27
Fnu4HI GCNGC 2 cut(s) 201, 261
Fsp4HI GCNGC 2 cut(s) 201, 261
FspBI CTAG 3 cut(s) 98, 104, 316
GluI GCNGC 2 cut(s) 201, 261
GsaI CCCAGC 1 cut(s) 89
GsuI CTGGAG 1 cut(s) 235
HaeIII GGCC 1 cut(s) 263
Hin1II CATG 1 cut(s) 166
HphI GGTGA 1 cut(s) 145
Hpy166II GTNNAC 1 cut(s) 28
Hpy188I TCNGA 1 cut(s) 52
Hpy188III TCNNGA 1 cut(s) 122
Hpy8I GTNNAC 1 cut(s) 28
HpyCH4V TGCA 1 cut(s) 132
HpyF10VI GCNNNNNNNGC 1 cut(s) 312
HpyF3I CTNAG 1 cut(s) 240
Hsp92II CATG 1 cut(s) 166
Ksp22I TGATCA 1 cut(s) 150
KspI CCGCGG 1 cut(s) 261
Kzo9I GATC 1 cut(s) 150
LmnI GCTCC 1 cut(s) 164
LpnPI CCDG 6 cut(s) 40, 99, 125, 152, 169, 265
MaeI CTAG 3 cut(s) 98, 104, 316
MalI GATC 1 cut(s) 152
MboI GATC 1 cut(s) 150
MboII GAAGA 3 cut(s) 16, 177, 180
MhlI GDGCHC 1 cut(s) 117
MluCI AATT 1 cut(s) 244
MmeI TCCRAC 1 cut(s) 75
MnlI CCTC 8 cut(s) 49, 52, 55, 58, 92, 118, 259, 285
MspA1I CMGCKG 1 cut(s) 260
MspR9I CCNGG 1 cut(s) 140
MvaI CCWGG 1 cut(s) 140
MvnI CGCG 1 cut(s) 260
MwoI GCNNNNNNNGC 1 cut(s) 312
NdeII GATC 1 cut(s) 150
NlaIII CATG 1 cut(s) 166
PaqCI CACCTGC 1 cut(s) 164
PkrI GCNGC 2 cut(s) 202, 262
PpuMI RGGWCCY 1 cut(s) 136
Psp5II RGGWCCY 1 cut(s) 136
Psp6I CCWGG 1 cut(s) 138
PspFI CCCAGC 1 cut(s) 85
PspGI CCWGG 1 cut(s) 138
PspPI GGNCC 1 cut(s) 136
PspPPI RGGWCCY 1 cut(s) 136
SacII CCGCGG 1 cut(s) 261
SatI GCNGC 2 cut(s) 201, 261
Sau3AI GATC 1 cut(s) 150
Sau96I GGNCC 1 cut(s) 136
ScrFI CCNGG 1 cut(s) 140
SduI GDGCHC 1 cut(s) 117
SetI ASST 5 cut(s) 59, 103, 138, 158, 317
SfcI CTRYAG 1 cut(s) 307
Sfr303I CCGCGG 1 cut(s) 261
SgrBI CCGCGG 1 cut(s) 261
SinI GGWCC 1 cut(s) 136
Sse9I AATT 1 cut(s) 244
SsiI CCGC 4 cut(s) 198, 201, 258, 260
SspMI CTAG 3 cut(s) 98, 104, 316
StyD4I CCNGG 1 cut(s) 138
TaqI TCGA 2 cut(s) 123, 285
TasI AATT 1 cut(s) 244
TauI GCSGC 2 cut(s) 203, 263
TspDTI ATGAA 2 cut(s) 17, 179
TspGWI ACGGA 1 cut(s) 100
VpaK11BI GGWCC 1 cut(s) 136
XagI CCTNNNNNAGG 1 cut(s) 52
XapI RAATTY 1 cut(s) 244
XmiI GTMKAC 1 cut(s) 27
XspI CTAG 3 cut(s) 98, 104, 316
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.