Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr05

Orthogroup ID

OG0011870

Physical Location & Seq

Genomic Coordinates Reverse (-)

26167968 .. 26168255

Gene Structure 288 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD05G1133100.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 288 bp

ATGATCCCCATTCATAGGTCTGAGATCCACATCTATGAATTGAAAGGTTCGAATGATCAAATATCAACAACAACCAGTTTTATTATGGGACAGCTCTTGATGTTCATATCGATCTATTATGTGCCTCTGCATCTAGCATTGGGTAGACCTCATACAATAAATGTCCTAGCTTTACCGTATCTTTTGTTTCATTTCTTCTGGAACAATCAAAAGACTTTTTTTATTATGGATCTACTACCAGAAATTCAATGCGTAATTTTTAGCATTGCAATGGTTATTCCTGAATAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0005215 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0006810 GO:0008104 GO:0008150 GO:0008565 GO:0009507 GO:0009526 GO:0009528 GO:0009536 GO:0009706 GO:0009941 GO:0015031 GO:0015833 GO:0016020 GO:0019866 GO:0031090 GO:0031967 GO:0031969 GO:0031975 GO:0033036 GO:0042170 GO:0042886 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044434 GO:0044435 GO:0044444 GO:0044446 GO:0044464 GO:0045184 GO:0051179 GO:0051234 GO:0071702 GO:0071705

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Ycf1

Protein Analysis

96

Amino Acids

11.1

Weight (kDa)

6.16

Isoelectric Point (pI)

36.04

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Ycf2	PF05695	2 - 25	6.7e-06	Ycf2 family
Ycf1	PF05758	15 - 75	4.6e-31	Ycf1

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011870)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G07739 ATCG01000 ATCG01130 ATMG00370
malus_domestica	MD05G1133100.v1.1 MD10G1298900.v1.1 MD16G1210100.v1.1
pyrus_communis	pycom12397g00110 pycom12397g00120 pycom14g17830 pycom16g17770
rosa_chinensis	RchiOBHm_Chr2g0173971 RchiOBHm_Chr4g0392781 RchiOBHm_Chr4g0392791 RchiOBHm_Chr5g0061381 RchiOBHm_Chr7g0221181
rosa_laevigata	RLG00000037097
rosa_roxburghii	Rroxscaffold_4G00323440
rosa_wichuraiana	Rw0G012090

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	145
AclWI	GGATC	2 cut(s)	19, 237
AcsI	RAATTY	1 cut(s)	243
AfiI	CCNNNNNNNGG	1 cut(s)	15
AgsI	TTSAA	2 cut(s)	43, 248
AluBI	AGCT	2 cut(s)	94, 170
AluI	AGCT	2 cut(s)	94, 170
AlwI	GGATC	2 cut(s)	19, 237
ApoI	RAATTY	1 cut(s)	243
AsuII	TTCGAA	1 cut(s)	50
BclI	TGATCA	1 cut(s)	55
BfaI	CTAG	2 cut(s)	134, 167
BmsI	GCATC	1 cut(s)	139
Bpu14I	TTCGAA	1 cut(s)	50
Bsa29I	ATCGAT	1 cut(s)	110
BsaBI	GATNNNNATC	1 cut(s)	29
Bsc4I	CCNNNNNNNGG	1 cut(s)	15
Bse1I	ACTGG	1 cut(s)	75
Bse3DI	GCAATG	2 cut(s)	264, 276
Bse8I	GATNNNNATC	1 cut(s)	29
BseCI	ATCGAT	1 cut(s)	110
BseJI	GATNNNNATC	1 cut(s)	29
BseLI	CCNNNNNNNGG	1 cut(s)	15
BseMI	GCAATG	2 cut(s)	264, 276
BseMII	CTCAG	1 cut(s)	12
BseNI	ACTGG	1 cut(s)	75
BshVI	ATCGAT	1 cut(s)	110
BslFI	GGGAC	1 cut(s)	102
BslI	CCNNNNNNNGG	1 cut(s)	15
BsmFI	GGGAC	1 cut(s)	102
Bsp119I	TTCGAA	1 cut(s)	50
Bsp143I	GATC	5 cut(s)	3, 24, 55, 111, 229
BspCNI	CTCAG	1 cut(s)	13
BspDI	ATCGAT	1 cut(s)	110
BspPI	GGATC	2 cut(s)	19, 237
BspT104I	TTCGAA	1 cut(s)	50
BsrDI	GCAATG	2 cut(s)	264, 276
BsrI	ACTGG	1 cut(s)	75
BssMI	GATC	5 cut(s)	3, 24, 55, 111, 229
Bst4CI	ACNGT	1 cut(s)	177
BstBI	TTCGAA	1 cut(s)	50
BstDEI	CTNAG	1 cut(s)	21
BstKTI	GATC	5 cut(s)	6, 27, 58, 114, 232
BstMBI	GATC	5 cut(s)	3, 24, 55, 111, 229
BstX2I	RGATCY	2 cut(s)	24, 229
BstYI	RGATCY	2 cut(s)	24, 229
Bsu15I	ATCGAT	1 cut(s)	110
BsuTUI	ATCGAT	1 cut(s)	110
ClaI	ATCGAT	1 cut(s)	110
CviJI	RGCY	2 cut(s)	94, 170
CviKI_1	RGCY	2 cut(s)	94, 170
DdeI	CTNAG	1 cut(s)	21
DpnI	GATC	5 cut(s)	5, 26, 57, 113, 231
DpnII	GATC	5 cut(s)	3, 24, 55, 111, 229
FaiI	YATR	7 cut(s)	15, 36, 86, 107, 120, 153, 227
FaqI	GGGAC	1 cut(s)	102
FbaI	TGATCA	1 cut(s)	55
FblI	GTMKAC	1 cut(s)	145
FspBI	CTAG	2 cut(s)	134, 167
Hpy166II	GTNNAC	1 cut(s)	146
Hpy188I	TCNGA	1 cut(s)	22
Hpy188III	TCNNGA	3 cut(s)	97, 199, 281
Hpy8I	GTNNAC	1 cut(s)	146
HpyCH4III	ACNGT	1 cut(s)	177
HpyCH4V	TGCA	2 cut(s)	130, 269
HpyF3I	CTNAG	1 cut(s)	21
Ksp22I	TGATCA	1 cut(s)	55
Kzo9I	GATC	5 cut(s)	3, 24, 55, 111, 229
LpnPI	CCDG	3 cut(s)	88, 184, 252
LweI	GCATC	1 cut(s)	139
MaeI	CTAG	2 cut(s)	134, 167
MalI	GATC	5 cut(s)	5, 26, 57, 113, 231
MboI	GATC	5 cut(s)	3, 24, 55, 111, 229
MboII	GAAGA	1 cut(s)	187
MflI	RGATCY	2 cut(s)	24, 229
MluCI	AATT	3 cut(s)	38, 243, 255
MnlI	CCTC	2 cut(s)	135, 159
MslI	CAYNNNNRTG	2 cut(s)	33, 269
NdeII	GATC	5 cut(s)	3, 24, 55, 111, 229
NspV	TTCGAA	1 cut(s)	50
PsuI	RGATCY	2 cut(s)	24, 229
RseI	CAYNNNNRTG	2 cut(s)	33, 269
Sau3AI	GATC	5 cut(s)	3, 24, 55, 111, 229
SetI	ASST	5 cut(s)	20, 49, 96, 151, 172
SfaNI	GCATC	1 cut(s)	139
SfuI	TTCGAA	1 cut(s)	50
SgeI	CNNG	6 cut(s)	87, 109, 146, 179, 211, 251
SmiMI	CAYNNNNRTG	2 cut(s)	33, 269
Sse9I	AATT	3 cut(s)	38, 243, 255
SspMI	CTAG	2 cut(s)	134, 167
TaaI	ACNGT	1 cut(s)	177
TaqI	TCGA	2 cut(s)	50, 110
TasI	AATT	3 cut(s)	38, 243, 255
TspDTI	ATGAA	3 cut(s)	51, 94, 179
XapI	RAATTY	1 cut(s)	243
XcmI	CCANNNNNNNNNTGG	1 cut(s)	82
XmiI	GTMKAC	1 cut(s)	145
XspI	CTAG	2 cut(s)	134, 167

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.