Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr16

Orthogroup ID

OG0011870

Physical Location & Seq

Genomic Coordinates Forward (+)

19847391 .. 19847555

Gene Structure 165 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD16G1210100.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 165 bp

ATGATGTTCATATCGATCTATTATGTGGCTCTACATCTAACATTAGGTAGACCTTATACAATAATTGTCCTAGATTTACCGTATCTTTTGTTTCATTTCTTCTGGAACAATCACAAACACTTTGTTTTTATATTATGGATCTACAACCAGAAATTCAATGCATAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Ycf1

Protein Analysis

55

Amino Acids

6.72

Weight (kDa)

9.23

Isoelectric Point (pI)

24.94

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Ycf1	PF05758	1 - 42	1.3e-19	Ycf1

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011870)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G07739 ATCG01000 ATCG01130 ATMG00370
malus_domestica	MD05G1133100.v1.1 MD10G1298900.v1.1 MD16G1210100.v1.1
pyrus_communis	pycom12397g00110 pycom12397g00120 pycom14g17830 pycom16g17770
rosa_chinensis	RchiOBHm_Chr2g0173971 RchiOBHm_Chr4g0392781 RchiOBHm_Chr4g0392791 RchiOBHm_Chr5g0061381 RchiOBHm_Chr7g0221181
rosa_laevigata	RLG00000037097
rosa_roxburghii	Rroxscaffold_4G00323440
rosa_wichuraiana	Rw0G012090

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	49
AclWI	GGATC	1 cut(s)	146
AcsI	RAATTY	1 cut(s)	152
AgsI	TTSAA	1 cut(s)	157
AlwI	GGATC	1 cut(s)	146
ApoI	RAATTY	1 cut(s)	152
BfaI	CTAG	1 cut(s)	71
Bsa29I	ATCGAT	1 cut(s)	14
BseCI	ATCGAT	1 cut(s)	14
BshVI	ATCGAT	1 cut(s)	14
Bsp143I	GATC	2 cut(s)	15, 138
BspDI	ATCGAT	1 cut(s)	14
BspPI	GGATC	1 cut(s)	146
BssMI	GATC	2 cut(s)	15, 138
Bst4CI	ACNGT	1 cut(s)	81
BstKTI	GATC	2 cut(s)	18, 141
BstMBI	GATC	2 cut(s)	15, 138
BstX2I	RGATCY	1 cut(s)	138
BstYI	RGATCY	1 cut(s)	138
Bsu15I	ATCGAT	1 cut(s)	14
BsuTUI	ATCGAT	1 cut(s)	14
ClaI	ATCGAT	1 cut(s)	14
CviJI	RGCY	1 cut(s)	29
CviKI_1	RGCY	1 cut(s)	29
DpnI	GATC	2 cut(s)	17, 140
DpnII	GATC	2 cut(s)	15, 138
EcoT22I	ATGCAT	1 cut(s)	163
FaiI	YATR	6 cut(s)	11, 24, 57, 131, 136, 163
FblI	GTMKAC	1 cut(s)	49
FspBI	CTAG	1 cut(s)	71
FspEI	CC	8 cut(s)	11, 30, 66, 83, 88, 93, 121, 161
Hpy166II	GTNNAC	1 cut(s)	50
Hpy188III	TCNNGA	1 cut(s)	103
Hpy8I	GTNNAC	1 cut(s)	50
HpyCH4III	ACNGT	1 cut(s)	81
HpyCH4V	TGCA	1 cut(s)	161
Kzo9I	GATC	2 cut(s)	15, 138
LpnPI	CCDG	2 cut(s)	88, 161
MaeI	CTAG	1 cut(s)	71
MalI	GATC	2 cut(s)	17, 140
MboI	GATC	2 cut(s)	15, 138
MboII	GAAGA	1 cut(s)	91
MflI	RGATCY	1 cut(s)	138
MluCI	AATT	2 cut(s)	63, 152
Mph1103I	ATGCAT	1 cut(s)	163
NdeII	GATC	2 cut(s)	15, 138
NsiI	ATGCAT	1 cut(s)	163
PsuI	RGATCY	1 cut(s)	138
Sau3AI	GATC	2 cut(s)	15, 138
SetI	ASST	2 cut(s)	49, 55
SgeI	CNNG	3 cut(s)	83, 115, 160
Sse9I	AATT	2 cut(s)	63, 152
SspMI	CTAG	1 cut(s)	71
TaaI	ACNGT	1 cut(s)	81
TaqI	TCGA	1 cut(s)	14
TasI	AATT	2 cut(s)	63, 152
TspDTI	ATGAA	1 cut(s)	83
XapI	RAATTY	1 cut(s)	152
XmiI	GTMKAC	1 cut(s)	49
XspI	CTAG	1 cut(s)	71
Zsp2I	ATGCAT	1 cut(s)	163

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.