RchiOBHm_Chr2g0173971

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
86754226 .. 86757843
3618 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ54114

Sequence Viewer

Length: 327 bp
ATGTACTTAATTTGCTGGCTAAGATTGAACTTCTTTACCAGATTTCTATCAAATCCGGTCGATTCACTAGCTAGAAGATCTACGAACCTAGATGTTCATCTAGAAAGAAATTTGATGAAACACAAAGGAAAAGGTGAGATCTACTCAAATCTGAATGTGAGTGTTTGTCCATATCTTGCGGTGATTTTATTTTTTTATTTTTTTGGTTCATTTGAGCTGTTCGTACTTCGTAGTGTTTTCTTAAGATTCAGAGTACTTCTGTATAAGCCAGCCATTTTAGAGAGCAGTTTAGCTCGACACAATCTTTTGTTAAATTGGGGAGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

108

Amino Acids

12.77

Weight (kDa)

9.93

Isoelectric Point (pI)

49.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 179
AcsI RAATTY 1 cut(s) 109
AfaI GTAC 3 cut(s) 5, 225, 255
AflII CTTAAG 1 cut(s) 241
AgsI TTSAA 1 cut(s) 28
AluBI AGCT 4 cut(s) 71, 217, 293, 323
AluI AGCT 4 cut(s) 71, 217, 293, 323
ApoI RAATTY 1 cut(s) 109
AsuHPI GGTGA 2 cut(s) 146, 193
BfaI CTAG 4 cut(s) 68, 72, 89, 101
BfrI CTTAAG 1 cut(s) 241
BglII AGATCT 2 cut(s) 77, 138
BmcAI AGTACT 1 cut(s) 255
BplI GAGNNNNNCTC 2 cut(s) 128, 160
BsaBI GATNNNNATC 2 cut(s) 46, 96
BsaWI WCCGGW 1 cut(s) 55
Bse8I GATNNNNATC 2 cut(s) 46, 96
BseJI GATNNNNATC 2 cut(s) 46, 96
Bsh1285I CGRYCG 1 cut(s) 60
BsiEI CGRYCG 1 cut(s) 60
BsiSI CCGG 1 cut(s) 56
Bsp143I GATC 2 cut(s) 77, 138
BspACI CCGC 1 cut(s) 179
BspTI CTTAAG 1 cut(s) 241
BssMI GATC 2 cut(s) 77, 138
BstAFI CTTAAG 1 cut(s) 241
BstC8I GCNNGC 2 cut(s) 17, 270
BstDEI CTNAG 1 cut(s) 20
BstKTI GATC 2 cut(s) 80, 141
BstMBI GATC 2 cut(s) 77, 138
BstMCI CGRYCG 1 cut(s) 60
BstX2I RGATCY 2 cut(s) 77, 138
BstYI RGATCY 2 cut(s) 77, 138
Cac8I GCNNGC 2 cut(s) 17, 270
Csp6I GTAC 3 cut(s) 4, 224, 254
CviJI RGCY 7 cut(s) 19, 71, 217, 268, 272, 293, 323
CviKI_1 RGCY 7 cut(s) 19, 71, 217, 268, 272, 293, 323
CviQI GTAC 3 cut(s) 4, 224, 254
DdeI CTNAG 1 cut(s) 20
DpnI GATC 2 cut(s) 79, 140
DpnII GATC 2 cut(s) 77, 138
FaiI YATR 2 cut(s) 172, 264
FspBI CTAG 4 cut(s) 68, 72, 89, 101
HapII CCGG 1 cut(s) 56
HinfI GANTC 2 cut(s) 62, 246
HpaII CCGG 1 cut(s) 56
HphI GGTGA 2 cut(s) 146, 193
Hpy188I TCNGA 2 cut(s) 153, 251
Hpy188III TCNNGA 1 cut(s) 101
HpyF3I CTNAG 1 cut(s) 20
Kzo9I GATC 2 cut(s) 77, 138
LmnI GCTCC 1 cut(s) 320
LpnPI CCDG 3 cut(s) 52, 69, 282
MaeI CTAG 4 cut(s) 68, 72, 89, 101
MalI GATC 2 cut(s) 79, 140
MboI GATC 2 cut(s) 77, 138
MboII GAAGA 1 cut(s) 87
MflI RGATCY 2 cut(s) 77, 138
MluCI AATT 3 cut(s) 9, 109, 313
MseI TTAA 3 cut(s) 8, 242, 311
MspCI CTTAAG 1 cut(s) 241
MspI CCGG 1 cut(s) 56
NdeII GATC 2 cut(s) 77, 138
PfeI GAWTC 2 cut(s) 62, 246
PsuI RGATCY 2 cut(s) 77, 138
RsaI GTAC 3 cut(s) 5, 225, 255
RsaNI GTAC 3 cut(s) 4, 224, 254
SaqAI TTAA 3 cut(s) 8, 242, 311
Sau3AI GATC 2 cut(s) 77, 138
ScaI AGTACT 1 cut(s) 255
SetI ASST 6 cut(s) 73, 90, 136, 219, 295, 325
SmlI CTYRAG 1 cut(s) 241
SmoI CTYRAG 1 cut(s) 241
Sse9I AATT 3 cut(s) 9, 109, 313
SsiI CCGC 1 cut(s) 179
SspMI CTAG 4 cut(s) 68, 72, 89, 101
TaqI TCGA 2 cut(s) 60, 295
TasI AATT 3 cut(s) 9, 109, 313
TatI WGTACW 2 cut(s) 3, 253
TfiI GAWTC 2 cut(s) 62, 246
Tru1I TTAA 3 cut(s) 8, 242, 311
Tru9I TTAA 3 cut(s) 8, 242, 311
TspDTI ATGAA 3 cut(s) 86, 131, 198
Vha464I CTTAAG 1 cut(s) 241
XapI RAATTY 1 cut(s) 109
XbaI TCTAGA 1 cut(s) 100
XspI CTAG 4 cut(s) 68, 72, 89, 101
ZrmI AGTACT 1 cut(s) 255
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.