RchiOBHm_Chr5g0061381

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
66809874 .. 66812623
2750 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ33776

Sequence Viewer

Length: 156 bp
ATGTACTTAATTTTCTGGCTAAGATTGAACTTCTTCACTAGATTTCTATCAAATCCAGTCGATTCACTAGCTAGAAGATCTACGAACCCAGACGTTCATCTAGAAAGAAATTTGATGAAACACAAAGGAAAAGCCCTATTGGCCAAATTCTTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

51

Amino Acids

6.12

Weight (kDa)

11.0

Isoelectric Point (pI)

40.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 141
AcsI RAATTY 2 cut(s) 109, 146
AfaI GTAC 1 cut(s) 5
AgsI TTSAA 1 cut(s) 28
AluBI AGCT 1 cut(s) 71
AluI AGCT 1 cut(s) 71
AoxI GGCC 1 cut(s) 141
ApoI RAATTY 2 cut(s) 109, 146
Asp700I GAANNNNTTC 1 cut(s) 32
BalI TGGCCA 1 cut(s) 143
BfaI CTAG 4 cut(s) 39, 68, 72, 101
BglI GCCNNNNNGGC 1 cut(s) 140
BglII AGATCT 1 cut(s) 77
BsaBI GATNNNNATC 1 cut(s) 46
Bse1I ACTGG 1 cut(s) 56
Bse8I GATNNNNATC 1 cut(s) 46
BseJI GATNNNNATC 1 cut(s) 46
BseNI ACTGG 1 cut(s) 56
BshFI GGCC 1 cut(s) 143
BsnI GGCC 1 cut(s) 143
Bsp143I GATC 1 cut(s) 77
BspANI GGCC 1 cut(s) 143
BsrI ACTGG 1 cut(s) 56
BssMI GATC 1 cut(s) 77
BstDEI CTNAG 1 cut(s) 20
BstKTI GATC 1 cut(s) 80
BstMBI GATC 1 cut(s) 77
BstMWI GCNNNNNNNGC 1 cut(s) 140
BstX2I RGATCY 1 cut(s) 77
BstYI RGATCY 1 cut(s) 77
BsuRI GGCC 1 cut(s) 143
Csp6I GTAC 1 cut(s) 4
CviJI RGCY 4 cut(s) 19, 71, 134, 143
CviKI_1 RGCY 4 cut(s) 19, 71, 134, 143
CviQI GTAC 1 cut(s) 4
DdeI CTNAG 1 cut(s) 20
DpnI GATC 1 cut(s) 79
DpnII GATC 1 cut(s) 77
EaeI YGGCCR 1 cut(s) 141
FaiI YATR 1 cut(s) 154
FspBI CTAG 4 cut(s) 39, 68, 72, 101
FspEI CC 7 cut(s) 69, 101, 102, 111, 125, 148, 149
HaeIII GGCC 1 cut(s) 143
HinfI GANTC 1 cut(s) 62
Hpy188III TCNNGA 1 cut(s) 101
HpyCH4IV ACGT 1 cut(s) 93
HpyF10VI GCNNNNNNNGC 1 cut(s) 140
HpyF3I CTNAG 1 cut(s) 20
HpySE526I ACGT 1 cut(s) 93
Kzo9I GATC 1 cut(s) 77
LpnPI CCDG 2 cut(s) 69, 102
MaeI CTAG 4 cut(s) 39, 68, 72, 101
MaeII ACGT 1 cut(s) 93
MalI GATC 1 cut(s) 79
MboI GATC 1 cut(s) 77
MboII GAAGA 2 cut(s) 25, 87
MflI RGATCY 1 cut(s) 77
MlsI TGGCCA 1 cut(s) 143
MluCI AATT 3 cut(s) 9, 109, 146
MluNI TGGCCA 1 cut(s) 143
Mox20I TGGCCA 1 cut(s) 143
MroXI GAANNNNTTC 1 cut(s) 32
MscI TGGCCA 1 cut(s) 143
MseI TTAA 1 cut(s) 8
Msp20I TGGCCA 1 cut(s) 143
MwoI GCNNNNNNNGC 1 cut(s) 140
NdeII GATC 1 cut(s) 77
PdmI GAANNNNTTC 1 cut(s) 32
PfeI GAWTC 1 cut(s) 62
PsuI RGATCY 1 cut(s) 77
RsaI GTAC 1 cut(s) 5
RsaNI GTAC 1 cut(s) 4
SaqAI TTAA 1 cut(s) 8
Sau3AI GATC 1 cut(s) 77
SetI ASST 2 cut(s) 73, 96
SgeI CNNG 7 cut(s) 28, 51, 68, 80, 84, 101, 113
Sse9I AATT 3 cut(s) 9, 109, 146
SspMI CTAG 4 cut(s) 39, 68, 72, 101
TaiI ACGT 1 cut(s) 96
TaqI TCGA 1 cut(s) 60
TasI AATT 3 cut(s) 9, 109, 146
TatI WGTACW 1 cut(s) 3
TfiI GAWTC 1 cut(s) 62
Tru1I TTAA 1 cut(s) 8
Tru9I TTAA 1 cut(s) 8
TspDTI ATGAA 2 cut(s) 86, 131
XapI RAATTY 2 cut(s) 109, 146
XbaI TCTAGA 1 cut(s) 100
XmnI GAANNNNTTC 1 cut(s) 32
XspI CTAG 4 cut(s) 39, 68, 72, 101
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.