MD06G1139500.v1.1

F-box LRR-repeat protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr06
OG0010565
Physical Location & Seq
Forward (+)
28406913 .. 28407526
614 bp
Loading structure...
UTR
Exon/CDS
Intron
MD06G1139500.v1.1.491

Sequence Viewer

Length: 357 bp
ATGGACGGGGCATCGTCGTCGGCGGCGGCGATAAAAACCGACACAAAACGGCCCCAAACGGCGGCGGCAGGGTTGTTTTCGCCGATAAACGACGACCTTCTCCACAACATCCTCTCGCACCTACCCGCCTTATCCTTCGCATCAGCGGCGTGCGTTAGCAAATCCTGGAACCAAATCTGCAGCCGAATCCTCACTCGCCCGAAGCTCGCCTCCGCCCTCTCTCTCCACCCCTCGCCTAAGGTTGCAGTGAAGGAGGTTATCGAGAAGGTTCTAGCTGAGCCTATACGGCCTCATTTTGTTGTAGCTAATATTGGAAGTGGGTTTGGATTGTATGACATTTCCAAGCTGCTCTTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
F-box FIST FIST_C

Protein Analysis

119

Amino Acids

12.49

Weight (kDa)

9.34

Isoelectric Point (pI)

53.06

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
F-box PF00646 30 - 62 3.6e-09 F-box domain
F-box-like PF12937 31 - 62 3.6e-07 F-box-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 355
AciI CCGC 7 cut(s) 23, 26, 62, 65, 126, 146, 213
AfiI CCNNNNNNNGG 1 cut(s) 61
AjnI CCWGG 1 cut(s) 164
AluBI AGCT 4 cut(s) 205, 275, 305, 346
AluI AGCT 4 cut(s) 205, 275, 305, 346
AoxI GGCC 2 cut(s) 50, 287
ApeKI GCWGC 2 cut(s) 180, 346
AspS9I GGNCC 1 cut(s) 51
AxyI CCTNAGG 1 cut(s) 237
BbvI GCAGC 2 cut(s) 192, 333
BceAI ACGGC 3 cut(s) 65, 75, 302
BcgI CGANNNNNNTGC 1 cut(s) 34
BciT130I CCWGG 1 cut(s) 166
BfaI CTAG 1 cut(s) 272
BfmI CTRYAG 1 cut(s) 178
BglI GCCNNNNNGGC 1 cut(s) 286
BisI GCNGC 7 cut(s) 24, 27, 63, 66, 147, 181, 347
BlpI GCTNAGC 1 cut(s) 276
BlsI GCNGC 7 cut(s) 25, 28, 64, 67, 148, 182, 348
Bme1390I CCNGG 1 cut(s) 166
BmgT120I GGNCC 1 cut(s) 51
BmiI GGNNCC 2 cut(s) 53, 170
BmrFI CCNGG 1 cut(s) 166
BmsI GCATC 2 cut(s) 20, 149
Bpu1102I GCTNAGC 1 cut(s) 276
Bsc4I CCNNNNNNNGG 1 cut(s) 61
Bse21I CCTNAGG 1 cut(s) 237
BseBI CCWGG 1 cut(s) 166
BseGI GGATG 1 cut(s) 108
BseLI CCNNNNNNNGG 1 cut(s) 61
BseMII CTCAG 1 cut(s) 267
BseXI GCAGC 2 cut(s) 192, 333
BshFI GGCC 2 cut(s) 52, 289
BslI CCNNNNNNNGG 1 cut(s) 61
BsnI GGCC 2 cut(s) 52, 289
Bsp1720I GCTNAGC 1 cut(s) 276
BspACI CCGC 7 cut(s) 23, 26, 62, 65, 126, 146, 213
BspANI GGCC 2 cut(s) 52, 289
BspCNI CTCAG 1 cut(s) 268
BspLI GGNNCC 2 cut(s) 53, 170
BspMAI CTGCAG 1 cut(s) 182
Bst2UI CCWGG 1 cut(s) 166
BstC8I GCNNGC 2 cut(s) 151, 207
BstDEI CTNAG 2 cut(s) 237, 276
BstF5I GGATG 1 cut(s) 108
BstMWI GCNNNNNNNGC 2 cut(s) 146, 286
BstNI CCWGG 1 cut(s) 166
BstSCI CCNGG 1 cut(s) 164
BstSFI CTRYAG 1 cut(s) 178
BstV1I GCAGC 2 cut(s) 192, 333
Bsu36I CCTNAGG 1 cut(s) 237
BsuRI GGCC 2 cut(s) 52, 289
BtsCI GGATG 1 cut(s) 108
BtsI GCAGTG 1 cut(s) 252
BtsIMutI CAGTG 1 cut(s) 252
Cac8I GCNNGC 2 cut(s) 151, 207
Cfr13I GGNCC 1 cut(s) 51
CviJI RGCY 8 cut(s) 52, 183, 205, 275, 280, 289, 305, 346
CviKI_1 RGCY 8 cut(s) 52, 183, 205, 275, 280, 289, 305, 346
DdeI CTNAG 2 cut(s) 237, 276
EciI GGCGGA 1 cut(s) 202
Eco81I CCTNAGG 1 cut(s) 237
EcoRII CCWGG 1 cut(s) 164
FaiI YATR 3 cut(s) 284, 333, 355
FalI AAGNNNNNCTT 1 cut(s) 335
FauI CCCGC 1 cut(s) 133
Fnu4HI GCNGC 7 cut(s) 24, 27, 63, 66, 147, 181, 347
FokI GGATG 1 cut(s) 95
Fsp4HI GCNGC 7 cut(s) 24, 27, 63, 66, 147, 181, 347
FspBI CTAG 1 cut(s) 272
GluI GCNGC 7 cut(s) 24, 27, 63, 66, 147, 181, 347
HaeIII GGCC 2 cut(s) 52, 289
HinfI GANTC 1 cut(s) 186
Hpy188III TCNNGA 1 cut(s) 262
Hpy99I CGWCG 3 cut(s) 19, 22, 95
HpyAV CCTTC 4 cut(s) 107, 145, 244, 259
HpyCH4V TGCA 2 cut(s) 180, 245
HpyF10VI GCNNNNNNNGC 2 cut(s) 146, 286
HpyF3I CTNAG 2 cut(s) 237, 276
LpnPI CCDG 3 cut(s) 54, 151, 178
Lsp1109I GCAGC 2 cut(s) 192, 333
LweI GCATC 2 cut(s) 20, 149
MaeI CTAG 1 cut(s) 272
MnlI CCTC 7 cut(s) 122, 200, 220, 227, 241, 247, 300
MspA1I CMGCKG 1 cut(s) 146
MspR9I CCNGG 1 cut(s) 166
MvaI CCWGG 1 cut(s) 166
MwoI GCNNNNNNNGC 2 cut(s) 146, 286
NlaIV GGNNCC 2 cut(s) 53, 170
PcsI WCGNNNNNNNCGW 1 cut(s) 26
PfeI GAWTC 1 cut(s) 186
PfoI TCCNGGA 1 cut(s) 164
PkrI GCNGC 7 cut(s) 25, 28, 64, 67, 148, 182, 348
PsiI TTATAA 1 cut(s) 355
Psp6I CCWGG 1 cut(s) 164
PspGI CCWGG 1 cut(s) 164
PspN4I GGNNCC 2 cut(s) 53, 170
PspPI GGNCC 1 cut(s) 51
PstI CTGCAG 1 cut(s) 182
SatI GCNGC 7 cut(s) 24, 27, 63, 66, 147, 181, 347
Sau96I GGNCC 1 cut(s) 51
ScrFI CCNGG 1 cut(s) 166
SetI ASST 9 cut(s) 99, 123, 207, 243, 258, 270, 277, 307, 348
SfaNI GCATC 2 cut(s) 20, 149
SfcI CTRYAG 1 cut(s) 178
SsiI CCGC 7 cut(s) 23, 26, 62, 65, 126, 146, 213
SspI AATATT 1 cut(s) 310
SspMI CTAG 1 cut(s) 272
StyD4I CCNGG 1 cut(s) 164
TaqI TCGA 1 cut(s) 261
TauI GCSGC 5 cut(s) 26, 29, 65, 68, 149
TfiI GAWTC 1 cut(s) 186
TscAI CASTG 1 cut(s) 252
TseI GCWGC 2 cut(s) 180, 346
TspRI CASTG 1 cut(s) 252
XspI CTAG 1 cut(s) 272
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.