MD06G1148500.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr06
Physical Location & Seq
Forward (+)
29124624 .. 29132883
8260 bp
Loading structure...
UTR
Exon/CDS
Intron
MD06G1148500.v1.1.491

Sequence Viewer

Length: 132 bp
ATGCTCTGCAAATGTCTTGTGGGAGCTGGAAGTGGGAGCTGGAAGGTACTCAAAGCTGGAGAATTGCTTTTCACTTATGAATTTGAGCTTATTCCGAACTTCGTCTCGTTTGTTACGTCCTCCAGAGATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

44

Amino Acids

4.74

Weight (kDa)

6.07

Isoelectric Point (pI)

5.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 80
AfaI GTAC 1 cut(s) 48
AluBI AGCT 4 cut(s) 26, 39, 56, 88
AluI AGCT 4 cut(s) 26, 39, 56, 88
Alw26I GTCTC 1 cut(s) 109
ApoI RAATTY 1 cut(s) 80
BcoDI GTCTC 1 cut(s) 109
BpmI CTGGAG 2 cut(s) 78, 106
BsmAI GTCTC 1 cut(s) 109
BsmBI CGTCTC 1 cut(s) 109
BstMAI GTCTC 1 cut(s) 109
Csp6I GTAC 1 cut(s) 47
CviJI RGCY 4 cut(s) 26, 39, 56, 88
CviKI_1 RGCY 4 cut(s) 26, 39, 56, 88
CviQI GTAC 1 cut(s) 47
Esp3I CGTCTC 1 cut(s) 109
FaiI YATR 1 cut(s) 78
FspEI CC 9 cut(s) 5, 6, 12, 18, 19, 25, 29, 42, 108
GsuI CTGGAG 2 cut(s) 78, 106
Hpy188I TCNGA 1 cut(s) 96
Hpy188III TCNNGA 1 cut(s) 123
HpyAV CCTTC 1 cut(s) 37
HpyCH4IV ACGT 1 cut(s) 116
HpyCH4V TGCA 1 cut(s) 9
HpySE526I ACGT 1 cut(s) 116
LmnI GCTCC 2 cut(s) 23, 36
LpnPI CCDG 3 cut(s) 12, 25, 42
MaeII ACGT 1 cut(s) 116
MaeIII GTNAC 1 cut(s) 112
MluCI AATT 2 cut(s) 62, 80
MnlI CCTC 1 cut(s) 130
PcsI WCGNNNNNNNCGW 1 cut(s) 113
RsaI GTAC 1 cut(s) 48
RsaNI GTAC 1 cut(s) 47
SetI ASST 6 cut(s) 28, 41, 48, 58, 90, 119
SgeI CNNG 5 cut(s) 29, 39, 52, 69, 118
Sse9I AATT 2 cut(s) 62, 80
TaiI ACGT 1 cut(s) 119
TasI AATT 2 cut(s) 62, 80
TspDTI ATGAA 1 cut(s) 93
XapI RAATTY 1 cut(s) 80
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.