Rroxscaffold_5G00385110

serine threonine-protein kinase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
OG0013588
Physical Location & Seq
Reverse (-)
64255469 .. 64256010
542 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00385110.1

Sequence Viewer

Length: 462 bp
ATGAGCATAGAAGACGTTGAGAAGAGGGTCAATAAGTTTTATGGTAACGACTTTAGCCTATGGAGGTCACGGATCGAGGACTACCTAAATATGAAGAAACTTGCTAGGACTTTAGAGGGCAAGCTCCCAAAAGATATGAAGGAGGAAGAATCGTCAATAGGATGGCCCTTGGAGCTGTTTGACTATCGCTTTCGAATGACGTACGGCGATTTGTTATCAAGGAGACTATTTCACTCGAAGATAGGTAAGGGTATATCCGTTTGCCAACAAGTTGGGATAGTTGGTGATATTATCGAGCAACTAGCGTTAGTGGATGTTAAATTCGACGAACACATCAAAGCTTTGGTGTTGTTGACTTCCATGCCTTCGGATTGGGATGTGACTGTGAACTTGATTTGTAATGGAGCTAAGACTACGAAGAAGTCGAAGTTTAATGATGTGCGTGACATTCTTCTCGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
B_lectin PAN_2 Pkinase_Tyr

Protein Analysis

153

Amino Acids

17.74

Weight (kDa)

6.75

Isoelectric Point (pI)

46.82

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Retrotran_gag_2 PF14223 71 - 151 1.3e-06 gag-polypeptide of LTR copia-type
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 80
AcsI RAATTY 1 cut(s) 320
AfaI GTAC 1 cut(s) 203
AluBI AGCT 4 cut(s) 124, 175, 341, 407
AluI AGCT 4 cut(s) 124, 175, 341, 407
Alw26I GTCTC 1 cut(s) 217
AlwI GGATC 1 cut(s) 80
AoxI GGCC 1 cut(s) 164
ApoI RAATTY 1 cut(s) 320
AspS9I GGNCC 1 cut(s) 165
AsuHPI GGTGA 1 cut(s) 296
AsuII TTCGAA 1 cut(s) 193
BbsI GAAGAC 1 cut(s) 18
BccI CCATC 1 cut(s) 156
BceAI ACGGC 1 cut(s) 220
BcoDI GTCTC 1 cut(s) 217
BfaI CTAG 2 cut(s) 105, 302
BmgT120I GGNCC 1 cut(s) 165
BpiI GAAGAC 1 cut(s) 18
Bpu14I TTCGAA 1 cut(s) 193
BsaJI CCNNGG 1 cut(s) 168
BseDI CCNNGG 1 cut(s) 168
BseGI GGATG 3 cut(s) 167, 319, 382
BshFI GGCC 1 cut(s) 166
BsiWI CGTACG 1 cut(s) 201
BsmAI GTCTC 1 cut(s) 217
BsnI GGCC 1 cut(s) 166
Bsp119I TTCGAA 1 cut(s) 193
Bsp143I GATC 1 cut(s) 72
BspANI GGCC 1 cut(s) 166
BspPI GGATC 1 cut(s) 80
BspT104I TTCGAA 1 cut(s) 193
BssECI CCNNGG 1 cut(s) 168
BssMI GATC 1 cut(s) 72
BssT1I CCWWGG 1 cut(s) 168
Bst4CI ACNGT 1 cut(s) 385
Bst6I CTCTTC 1 cut(s) 17
BstBI TTCGAA 1 cut(s) 193
BstC8I GCNNGC 1 cut(s) 122
BstDEI CTNAG 1 cut(s) 408
BstF5I GGATG 3 cut(s) 167, 319, 382
BstKTI GATC 1 cut(s) 75
BstMAI GTCTC 1 cut(s) 217
BstMBI GATC 1 cut(s) 72
BstMWI GCNNNNNNNGC 1 cut(s) 172
BstV2I GAAGAC 1 cut(s) 18
BstXI CCANNNNNNTGG 1 cut(s) 272
BsuRI GGCC 1 cut(s) 166
BtsCI GGATG 3 cut(s) 167, 319, 382
Cac8I GCNNGC 1 cut(s) 122
Cfr13I GGNCC 1 cut(s) 165
Csp6I GTAC 1 cut(s) 202
CviAII CATG 1 cut(s) 361
CviJI RGCY 6 cut(s) 57, 124, 166, 175, 341, 407
CviKI_1 RGCY 6 cut(s) 57, 124, 166, 175, 341, 407
CviQI GTAC 1 cut(s) 202
DdeI CTNAG 1 cut(s) 408
DpnI GATC 1 cut(s) 74
DpnII GATC 1 cut(s) 72
Eam1104I CTCTTC 1 cut(s) 17
EarI CTCTTC 1 cut(s) 17
Eco130I CCWWGG 1 cut(s) 168
EcoT14I CCWWGG 1 cut(s) 168
ErhI CCWWGG 1 cut(s) 168
FaeI CATG 1 cut(s) 364
FaiI YATR 7 cut(s) 8, 42, 61, 92, 137, 254, 362
FatI CATG 1 cut(s) 360
FokI GGATG 3 cut(s) 174, 326, 389
FspBI CTAG 2 cut(s) 105, 302
HaeIII GGCC 1 cut(s) 166
Hin1II CATG 1 cut(s) 364
HincII GTYRAC 1 cut(s) 354
HindII GTYRAC 1 cut(s) 354
HindIII AAGCTT 1 cut(s) 339
HinfI GANTC 1 cut(s) 149
HphI GGTGA 1 cut(s) 296
Hpy166II GTNNAC 2 cut(s) 354, 388
Hpy188I TCNGA 1 cut(s) 370
Hpy188III TCNNGA 1 cut(s) 455
Hpy8I GTNNAC 2 cut(s) 354, 388
Hpy99I CGWCG 1 cut(s) 329
HpyAV CCTTC 2 cut(s) 133, 375
HpyCH4III ACNGT 1 cut(s) 385
HpyCH4IV ACGT 2 cut(s) 15, 200
HpyF10VI GCNNNNNNNGC 1 cut(s) 172
HpyF3I CTNAG 1 cut(s) 408
HpySE526I ACGT 2 cut(s) 15, 200
Hsp92II CATG 1 cut(s) 364
Kzo9I GATC 1 cut(s) 72
LmnI GCTCC 3 cut(s) 129, 172, 404
MaeI CTAG 2 cut(s) 105, 302
MaeII ACGT 2 cut(s) 15, 200
MaeIII GTNAC 4 cut(s) 44, 66, 379, 443
MalI GATC 1 cut(s) 74
MboI GATC 1 cut(s) 72
MboII GAAGA 7 cut(s) 23, 34, 106, 158, 250, 430, 443
MluCI AATT 1 cut(s) 320
MnlI CCTC 5 cut(s) 18, 57, 70, 109, 136
MseI TTAA 2 cut(s) 318, 432
MwoI GCNNNNNNNGC 1 cut(s) 172
NdeII GATC 1 cut(s) 72
NlaIII CATG 1 cut(s) 364
NmuCI GTSAC 3 cut(s) 66, 379, 443
NspV TTCGAA 1 cut(s) 193
PcsI WCGNNNNNNNCGW 1 cut(s) 422
PfeI GAWTC 1 cut(s) 149
Pfl23II CGTACG 1 cut(s) 201
PspLI CGTACG 1 cut(s) 201
PspPI GGNCC 1 cut(s) 165
RsaI GTAC 1 cut(s) 203
RsaNI GTAC 1 cut(s) 202
SaqAI TTAA 2 cut(s) 318, 432
Sau3AI GATC 1 cut(s) 72
Sau96I GGNCC 1 cut(s) 165
SetI ASST 9 cut(s) 18, 68, 87, 126, 177, 203, 247, 343, 409
SfuI TTCGAA 1 cut(s) 193
Sse9I AATT 1 cut(s) 320
SspMI CTAG 2 cut(s) 105, 302
StyI CCWWGG 1 cut(s) 168
TaaI ACNGT 1 cut(s) 385
TaiI ACGT 2 cut(s) 18, 203
TaqI TCGA 7 cut(s) 75, 193, 236, 294, 324, 425, 456
TasI AATT 1 cut(s) 320
TfiI GAWTC 1 cut(s) 149
Tru1I TTAA 2 cut(s) 318, 432
Tru9I TTAA 2 cut(s) 318, 432
TseFI GTSAC 3 cut(s) 66, 379, 443
Tsp45I GTSAC 3 cut(s) 66, 379, 443
TspDTI ATGAA 2 cut(s) 107, 152
TspGWI ACGGA 2 cut(s) 85, 247
XapI RAATTY 1 cut(s) 320
XspI CTAG 2 cut(s) 105, 302
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.