MD09G1244800.v1.1

Exosome complex component

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr09
Physical Location & Seq
Reverse (-)
31208390 .. 31211636
3247 bp
Loading structure...
UTR
Exon/CDS
Intron
MD09G1244800.v1.1.491

Sequence Viewer

Length: 276 bp
ATGGAGCACACTCAGTGGAGCCATTTACCACTACTGGTGTCCCTACTGATTTATTACCATATACCAATCCAAGTCCAAACTGATCACAAAGGATCGGACCACAAAAATTTATCTTCAGTGCTTCATAAAGCTTTAGAGGGTGCAATCATATTTGAAACTTTCCCCAAGACTATTATGGATGTTTTTGCATTGGTGTTGGAATCTATGAGCAGTAAGTTTTTCCATTGGTTTTTAATATCTAAGCATCTATTCTTTCGGCCATTTATGTTTATGTGA

Protein Analysis

92

Amino Acids

10.78

Weight (kDa)

7.1

Isoelectric Point (pI)

40.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 100
AcoI YGGCCR 1 cut(s) 257
AcsI RAATTY 1 cut(s) 106
AcuI CTGAAG 1 cut(s) 99
AdeI CACNNNGTG 1 cut(s) 15
AgsI TTSAA 1 cut(s) 155
AluBI AGCT 1 cut(s) 131
AluI AGCT 1 cut(s) 131
Alw21I GWGCWC 1 cut(s) 9
AlwI GGATC 1 cut(s) 100
AoxI GGCC 1 cut(s) 257
ApoI RAATTY 1 cut(s) 106
AspS9I GGNCC 1 cut(s) 97
AvaII GGWCC 1 cut(s) 97
Bbv12I GWGCWC 1 cut(s) 9
BclI TGATCA 1 cut(s) 82
Bme18I GGWCC 1 cut(s) 97
BmgT120I GGNCC 1 cut(s) 97
BmiI GGNNCC 1 cut(s) 20
BmsI GCATC 1 cut(s) 253
Bse1I ACTGG 1 cut(s) 39
BseGI GGATG 1 cut(s) 184
BseMII CTCAG 1 cut(s) 26
BseNI ACTGG 1 cut(s) 39
BshFI GGCC 1 cut(s) 259
BsiHKAI GWGCWC 1 cut(s) 9
BslFI GGGAC 1 cut(s) 25
BsmFI GGGAC 1 cut(s) 25
BsnI GGCC 1 cut(s) 259
Bsp1286I GDGCHC 1 cut(s) 9
Bsp143I GATC 2 cut(s) 82, 92
BspANI GGCC 1 cut(s) 259
BspCNI CTCAG 1 cut(s) 25
BspLI GGNNCC 1 cut(s) 20
BspPI GGATC 1 cut(s) 100
BsrI ACTGG 1 cut(s) 39
BssMI GATC 2 cut(s) 82, 92
BstDEI CTNAG 2 cut(s) 12, 240
BstF5I GGATG 1 cut(s) 184
BstKTI GATC 2 cut(s) 85, 95
BstMBI GATC 2 cut(s) 82, 92
BsuRI GGCC 1 cut(s) 259
BtsCI GGATG 1 cut(s) 184
BtsIMutI CAGTG 2 cut(s) 20, 123
Cfr13I GGNCC 1 cut(s) 97
CviJI RGCY 3 cut(s) 21, 131, 259
CviKI_1 RGCY 3 cut(s) 21, 131, 259
DdeI CTNAG 2 cut(s) 12, 240
DpnI GATC 2 cut(s) 84, 94
DpnII GATC 2 cut(s) 82, 92
DraIII CACNNNGTG 1 cut(s) 15
EaeI YGGCCR 1 cut(s) 257
Eco47I GGWCC 1 cut(s) 97
Eco57I CTGAAG 1 cut(s) 99
FaiI YATR 8 cut(s) 60, 62, 126, 149, 176, 206, 266, 272
FaqI GGGAC 1 cut(s) 25
FbaI TGATCA 1 cut(s) 82
FokI GGATG 1 cut(s) 191
HaeIII GGCC 1 cut(s) 259
HindIII AAGCTT 1 cut(s) 129
HinfI GANTC 1 cut(s) 200
Hpy188I TCNGA 1 cut(s) 97
HpyCH4V TGCA 2 cut(s) 143, 188
HpyF3I CTNAG 2 cut(s) 12, 240
Ksp22I TGATCA 1 cut(s) 82
Kzo9I GATC 2 cut(s) 82, 92
LmnI GCTCC 2 cut(s) 4, 18
LpnPI CCDG 1 cut(s) 20
LweI GCATC 1 cut(s) 253
MalI GATC 2 cut(s) 84, 94
MboI GATC 2 cut(s) 82, 92
MboII GAAGA 1 cut(s) 105
MhlI GDGCHC 1 cut(s) 9
MluCI AATT 1 cut(s) 106
MmeI TCCRAC 1 cut(s) 177
MnlI CCTC 1 cut(s) 130
MseI TTAA 1 cut(s) 233
NdeII GATC 2 cut(s) 82, 92
NlaIV GGNNCC 1 cut(s) 20
PfeI GAWTC 1 cut(s) 200
PspN4I GGNNCC 1 cut(s) 20
PspPI GGNCC 1 cut(s) 97
SaqAI TTAA 1 cut(s) 233
Sau3AI GATC 2 cut(s) 82, 92
Sau96I GGNCC 1 cut(s) 97
SduI GDGCHC 1 cut(s) 9
SetI ASST 1 cut(s) 133
SfaNI GCATC 1 cut(s) 253
SgeI CNNG 3 cut(s) 47, 83, 178
SinI GGWCC 1 cut(s) 97
Sse9I AATT 1 cut(s) 106
TasI AATT 1 cut(s) 106
TfiI GAWTC 1 cut(s) 200
Tru1I TTAA 1 cut(s) 233
Tru9I TTAA 1 cut(s) 233
TscAI CASTG 2 cut(s) 20, 123
TspDTI ATGAA 1 cut(s) 113
TspRI CASTG 2 cut(s) 20, 123
VpaK11BI GGWCC 1 cut(s) 97
XapI RAATTY 1 cut(s) 106
XcmI CCANNNNNNNNNTGG 1 cut(s) 172
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.