MD09G1283900.v1.1

Domain of unknown function (DUF4033)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr09
OG0002743
Physical Location & Seq
Reverse (-)
36174345 .. 36176613
2269 bp
Loading structure...
UTR
Exon/CDS
Intron
MD09G1283900.v1.1.491

Sequence Viewer

Length: 810 bp
ATGAAGGCTTCGGCTGTTGTTGGCCCTCCGACCACCATTTTCTCATGCTCATCTCCGCCACCACAGTTTCAATCCCAACCCAAATCTCAGCTGCTCCGAAACCAACGCTTTCGGGTCTCATCCTCTTTGATAAAAGAGCCACAATCCCAATTCCGGGAGAAGCAGCAGAAGCTTGGAGTGATGGACGAATTGTTCCTCAAGGTGTTTAGAAGCAAAATGGCTGCGGAAGTTGGATGGGATTCCGAAAAGCCCGGATACGACGGACTCATTGATGTGGCGAATCGGCTAATGCTCAAAAGTCCAACCAATTCTCACGCTAAAGAAGCTGCGGTAAGAATATTGAGATCCTTGTTCCCGCCGTTACTGTTAGACCTTTATAAGTTGCTGGTAGCACCCTTACAAGGAGGAAAAGTAGCTGCCATCATGGTTGCAAGGGTGACTGCAATTACTTGTCAATGGCTTATGGGTCCTTGCACAGTAAACTCAGTCGACTTACCAGACGGGACTTCATGGAACAGTGGGGTGTTTGTAGAGAAATGCAAGTACTTGGAAGAAAGCAAATGCGTCGGTATATGTCTGAATACTTGTAAGCTTCCAACTCAGGCTTTCATCAAAGATTATATGGGCGTTCCGTTAGTGATGGAGCCGAACTTCGTCGATTACAGCTGCCAGTTTAAATTCGGTGTCCTCCCCCCACTTCCTGAAGATGATGCCACTCTCAAAGAACCCTGCTTAGAAATCTGCCCTAACGCCACTCGACGGAGAGAAATCGCCAGAAATATTAACGTCGAGAAATGTCCCAAGGCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4033

Protein Analysis

270

Amino Acids

29.91

Weight (kDa)

8.92

Isoelectric Point (pI)

55.23

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
D27-like_C PF13225 153 - 234 5.9e-34 Beta-carotene isomerase D27-like, C-terminal
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 378
AccI GTMKAC 1 cut(s) 489
AciI CCGC 4 cut(s) 56, 224, 329, 356
AclWI GGATC 1 cut(s) 339
AcsI RAATTY 1 cut(s) 677
AcuI CTGAAG 1 cut(s) 723
AfaI GTAC 1 cut(s) 545
AfiI CCNNNNNNNGG 4 cut(s) 153, 154, 401, 759
AgsI TTSAA 1 cut(s) 71
AloI GAACNNNNNNTCC 2 cut(s) 176, 208
AluBI AGCT 6 cut(s) 91, 172, 326, 416, 592, 666
AluI AGCT 6 cut(s) 91, 172, 326, 416, 592, 666
Alw26I GTCTC 1 cut(s) 121
AlwI GGATC 1 cut(s) 339
AoxI GGCC 1 cut(s) 22
ApeKI GCWGC 6 cut(s) 91, 163, 221, 326, 416, 666
ApoI RAATTY 1 cut(s) 677
AspS9I GGNCC 2 cut(s) 23, 467
AsuC2I CCSGG 2 cut(s) 155, 252
AsuHPI GGTGA 1 cut(s) 448
AvaII GGWCC 1 cut(s) 467
BbvI GCAGC 6 cut(s) 78, 175, 208, 313, 403, 653
BccI CCATC 4 cut(s) 175, 228, 428, 634
BceAI ACGGC 1 cut(s) 343
BcgI CGANNNNNNTGC 2 cut(s) 547, 581
BciVI GTATCC 1 cut(s) 248
BcnI CCSGG 2 cut(s) 155, 252
BcoDI GTCTC 1 cut(s) 121
BfuI GTATCC 1 cut(s) 248
BisI GCNGC 6 cut(s) 92, 164, 222, 327, 417, 667
BlsI GCNGC 6 cut(s) 93, 165, 223, 328, 418, 668
BmcAI AGTACT 1 cut(s) 545
Bme1390I CCNGG 2 cut(s) 155, 252
Bme18I GGWCC 1 cut(s) 467
BmgT120I GGNCC 2 cut(s) 23, 467
BmiI GGNNCC 2 cut(s) 468, 645
BmrFI CCNGG 2 cut(s) 155, 252
BmsI GCATC 1 cut(s) 700
BpuEI CTTGAG 1 cut(s) 182
BpuMI CCSGG 2 cut(s) 155, 252
BsaI GGTCTC 1 cut(s) 121
BsaJI CCNNGG 1 cut(s) 801
BsaXI ACNNNNNCTCC 2 cut(s) 396, 426
Bsc4I CCNNNNNNNGG 4 cut(s) 153, 154, 401, 759
Bse1I ACTGG 1 cut(s) 670
BseDI CCNNGG 1 cut(s) 801
BseGI GGATG 2 cut(s) 119, 239
BseLI CCNNNNNNNGG 4 cut(s) 153, 154, 401, 759
BseMII CTCAG 3 cut(s) 101, 498, 614
BseNI ACTGG 1 cut(s) 670
BseXI GCAGC 6 cut(s) 78, 175, 208, 313, 403, 653
BshFI GGCC 1 cut(s) 24
BsiSI CCGG 2 cut(s) 154, 252
BslFI GGGAC 2 cut(s) 517, 783
BslI CCNNNNNNNGG 4 cut(s) 153, 154, 401, 759
BsmAI GTCTC 1 cut(s) 121
BsmFI GGGAC 2 cut(s) 517, 783
BsnI GGCC 1 cut(s) 24
Bso31I GGTCTC 1 cut(s) 121
Bsp143I GATC 1 cut(s) 344
BspACI CCGC 4 cut(s) 56, 224, 329, 356
BspANI GGCC 1 cut(s) 24
BspCNI CTCAG 3 cut(s) 100, 497, 613
BspLI GGNNCC 2 cut(s) 468, 645
BspPI GGATC 1 cut(s) 339
BspTNI GGTCTC 1 cut(s) 121
BsrI ACTGG 1 cut(s) 670
BssECI CCNNGG 1 cut(s) 801
BssMI GATC 1 cut(s) 344
BssT1I CCWWGG 1 cut(s) 801
Bst4CI ACNGT 4 cut(s) 66, 366, 478, 518
BstDEI CTNAG 4 cut(s) 87, 484, 600, 733
BstF5I GGATG 2 cut(s) 119, 239
BstKTI GATC 1 cut(s) 347
BstMAI GTCTC 1 cut(s) 121
BstMBI GATC 1 cut(s) 344
BstMWI GCNNNNNNNGC 2 cut(s) 169, 323
BstSCI CCNGG 2 cut(s) 153, 250
BstV1I GCAGC 6 cut(s) 78, 175, 208, 313, 403, 653
BstX2I RGATCY 1 cut(s) 344
BstYI RGATCY 1 cut(s) 344
BsuI GTATCC 1 cut(s) 248
BsuRI GGCC 1 cut(s) 24
BtsCI GGATG 2 cut(s) 119, 239
BtsIMutI CAGTG 1 cut(s) 523
Cfr13I GGNCC 2 cut(s) 23, 467
CseI GACGC 1 cut(s) 553
Csp6I GTAC 1 cut(s) 544
CviAII CATG 4 cut(s) 45, 424, 510, 807
CviQI GTAC 1 cut(s) 544
DdeI CTNAG 4 cut(s) 87, 484, 600, 733
DpnI GATC 1 cut(s) 346
DpnII GATC 1 cut(s) 344
DraI TTTAAA 1 cut(s) 676
EciI GGCGGA 1 cut(s) 45
Eco130I CCWWGG 1 cut(s) 801
Eco31I GGTCTC 1 cut(s) 121
Eco47I GGWCC 1 cut(s) 467
Eco57I CTGAAG 1 cut(s) 723
EcoO109I RGGNCCY 1 cut(s) 467
EcoT14I CCWWGG 1 cut(s) 801
ErhI CCWWGG 1 cut(s) 801
FaeI CATG 4 cut(s) 48, 427, 513, 810
FaqI GGGAC 2 cut(s) 517, 783
FatI CATG 4 cut(s) 44, 423, 509, 806
FauI CCCGC 1 cut(s) 363
FblI GTMKAC 1 cut(s) 489
Fnu4HI GCNGC 6 cut(s) 92, 164, 222, 327, 417, 667
FokI GGATG 2 cut(s) 106, 246
Fsp4HI GCNGC 6 cut(s) 92, 164, 222, 327, 417, 667
GluI GCNGC 6 cut(s) 92, 164, 222, 327, 417, 667
HaeIII GGCC 1 cut(s) 24
HapII CCGG 2 cut(s) 154, 252
HgaI GACGC 1 cut(s) 553
Hin1II CATG 4 cut(s) 48, 427, 513, 810
HincII GTYRAC 1 cut(s) 490
HindII GTYRAC 1 cut(s) 490
HindIII AAGCTT 2 cut(s) 170, 590
HinfI GANTC 3 cut(s) 239, 264, 280
HpaII CCGG 2 cut(s) 154, 252
HphI GGTGA 1 cut(s) 448
Hpy166II GTNNAC 2 cut(s) 481, 490
Hpy188I TCNGA 4 cut(s) 30, 98, 244, 579
Hpy188III TCNNGA 2 cut(s) 701, 790
Hpy8I GTNNAC 2 cut(s) 481, 490
Hpy99I CGWCG 5 cut(s) 263, 569, 659, 762, 791
HpyCH4III ACNGT 4 cut(s) 66, 366, 478, 518
HpyCH4IV ACGT 1 cut(s) 786
HpyCH4V TGCA 4 cut(s) 431, 443, 474, 540
HpyF10VI GCNNNNNNNGC 2 cut(s) 169, 323
HpyF3I CTNAG 4 cut(s) 87, 484, 600, 733
HpySE526I ACGT 1 cut(s) 786
Hsp92II CATG 4 cut(s) 48, 427, 513, 810
Kzo9I GATC 1 cut(s) 344
LmnI GCTCC 2 cut(s) 99, 643
LpnPI CCDG 9 cut(s) 167, 265, 371, 510, 587, 683, 714, 742, 787
Lsp1109I GCAGC 6 cut(s) 78, 175, 208, 313, 403, 653
LweI GCATC 1 cut(s) 700
MaeII ACGT 1 cut(s) 786
MaeIII GTNAC 2 cut(s) 360, 436
MalI GATC 1 cut(s) 346
MboI GATC 1 cut(s) 344
MboII GAAGA 2 cut(s) 563, 716
MflI RGATCY 1 cut(s) 344
MluCI AATT 5 cut(s) 149, 188, 307, 444, 677
MlyI GAGTC 1 cut(s) 258
MmeI TCCRAC 4 cut(s) 53, 211, 326, 620
MnlI CCTC 5 cut(s) 36, 133, 206, 398, 698
MseI TTAA 2 cut(s) 675, 783
MslI CAYNNNNRTG 1 cut(s) 272
MspA1I CMGCKG 2 cut(s) 91, 666
MspI CCGG 2 cut(s) 154, 252
MspR9I CCNGG 2 cut(s) 155, 252
MwoI GCNNNNNNNGC 2 cut(s) 169, 323
NciI CCSGG 2 cut(s) 155, 252
NdeII GATC 1 cut(s) 344
NlaIII CATG 4 cut(s) 48, 427, 513, 810
NlaIV GGNNCC 2 cut(s) 468, 645
NmuCI GTSAC 1 cut(s) 436
PfeI GAWTC 2 cut(s) 239, 280
PfoI TCCNGGA 1 cut(s) 153
PkrI GCNGC 6 cut(s) 93, 165, 223, 328, 418, 668
PleI GAGTC 1 cut(s) 258
PpsI GAGTC 1 cut(s) 258
PpuMI RGGWCCY 1 cut(s) 467
PsiI TTATAA 1 cut(s) 378
Psp5II RGGWCCY 1 cut(s) 467
PspN4I GGNNCC 2 cut(s) 468, 645
PspPI GGNCC 2 cut(s) 23, 467
PspPPI RGGWCCY 1 cut(s) 467
PsuI RGATCY 1 cut(s) 344
PvuII CAGCTG 2 cut(s) 91, 666
RsaI GTAC 1 cut(s) 545
RsaNI GTAC 1 cut(s) 544
RseI CAYNNNNRTG 1 cut(s) 272
SalI GTCGAC 1 cut(s) 488
SaqAI TTAA 2 cut(s) 675, 783
SatI GCNGC 6 cut(s) 92, 164, 222, 327, 417, 667
Sau3AI GATC 1 cut(s) 344
Sau96I GGNCC 2 cut(s) 23, 467
ScaI AGTACT 1 cut(s) 545
SchI GAGTC 1 cut(s) 258
ScrFI CCNGG 2 cut(s) 155, 252
SetI ASST 9 cut(s) 93, 174, 204, 328, 375, 418, 594, 668, 789
SfaNI GCATC 1 cut(s) 700
SinI GGWCC 1 cut(s) 467
SmiMI CAYNNNNRTG 1 cut(s) 272
SmlI CTYRAG 1 cut(s) 197
SmoI CTYRAG 1 cut(s) 197
Sse9I AATT 5 cut(s) 149, 188, 307, 444, 677
SsiI CCGC 4 cut(s) 56, 224, 329, 356
SspI AATATT 2 cut(s) 339, 781
StyD4I CCNGG 2 cut(s) 153, 250
StyI CCWWGG 1 cut(s) 801
TaaI ACNGT 4 cut(s) 66, 366, 478, 518
TaiI ACGT 1 cut(s) 789
TaqI TCGA 4 cut(s) 489, 657, 757, 789
TasI AATT 5 cut(s) 149, 188, 307, 444, 677
TatI WGTACW 1 cut(s) 543
TfiI GAWTC 2 cut(s) 239, 280
Tru1I TTAA 2 cut(s) 675, 783
Tru9I TTAA 2 cut(s) 675, 783
TscAI CASTG 1 cut(s) 523
TseFI GTSAC 1 cut(s) 436
TseI GCWGC 6 cut(s) 91, 163, 221, 326, 416, 666
Tsp45I GTSAC 1 cut(s) 436
TspDTI ATGAA 3 cut(s) 17, 498, 598
TspGWI ACGGA 3 cut(s) 276, 621, 775
TspRI CASTG 1 cut(s) 523
VpaK11BI GGWCC 1 cut(s) 467
XapI RAATTY 1 cut(s) 677
XmiI GTMKAC 1 cut(s) 489
ZrmI AGTACT 1 cut(s) 545
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.