pycom17g27480

Domain of unknown function (DUF4033)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
OG0002743
Physical Location & Seq
Reverse (-)
25634768 .. 25635309
542 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom17g27480.1

Sequence Viewer

Length: 456 bp
ATGGTTGCAAGGGTAACTGCAATTACTTGTCAATGGCTCATGGGTCCTTACGCACTAAATTCTATCGACTTACCAGACAGGACCTCATGGAGTAGTGGGGGTTCACCATTGATGCAGGTGTTTGTAGAGAAATGCAAGTACTTAGAAGAAAGCAAATGCGTCGGTATATGTCTGAATACTTGCAGGCTGTCTTCAAAAGATTACATGGGCGTTGCTTTTGCGATGGAGCCAAACTTCGTCGATCATAGCCGTCAGGTAAAACCCCAAGACCTCTACAGCTCTACTCATTTCCACATATTGATTGTCCTACAATTGACTCTCTCAATTGAACTCGAACACGGCAATTTAAATTCGGGGTTCTCCCTCCGCTTCCTGAAGCTGATGCCACTCCTCAAGGAACCATGTCTGGAGATCTGCCCTAACGCCTTTCGACCAAGAGAAAAAACATTAACGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4033

Protein Analysis

152

Amino Acids

17.1

Weight (kDa)

7.59

Isoelectric Point (pI)

40.85

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
D27-like_C PF13225 12 - 86 4.6e-18 Beta-carotene isomerase D27-like, C-terminal
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 106
Acc36I ACCTGC 1 cut(s) 106
AciI CCGC 1 cut(s) 367
AcsI RAATTY 2 cut(s) 58, 349
AcuI CTGAAG 1 cut(s) 395
AfaI GTAC 1 cut(s) 140
AgsI TTSAA 2 cut(s) 195, 329
AluBI AGCT 2 cut(s) 279, 379
AluI AGCT 2 cut(s) 279, 379
ApoI RAATTY 2 cut(s) 58, 349
AspS9I GGNCC 2 cut(s) 44, 81
AsuHPI GGTGA 1 cut(s) 96
AvaII GGWCC 2 cut(s) 44, 81
BbsI GAAGAC 1 cut(s) 183
BccI CCATC 1 cut(s) 217
BceAI ACGGC 2 cut(s) 234, 355
BcgI CGANNNNNNTGC 2 cut(s) 142, 176
BfmI CTRYAG 1 cut(s) 274
BfuAI ACCTGC 1 cut(s) 106
BglII AGATCT 1 cut(s) 411
BmcAI AGTACT 1 cut(s) 140
Bme18I GGWCC 2 cut(s) 44, 81
BmgT120I GGNCC 2 cut(s) 44, 81
BmiI GGNNCC 3 cut(s) 45, 228, 399
BmsI GCATC 2 cut(s) 102, 372
BpiI GAAGAC 1 cut(s) 183
BpmI CTGGAG 1 cut(s) 428
BpuEI CTTGAG 1 cut(s) 377
BseRI GAGGAG 1 cut(s) 380
Bsp143I GATC 2 cut(s) 241, 411
BspACI CCGC 1 cut(s) 367
BspLI GGNNCC 3 cut(s) 45, 228, 399
BspMI ACCTGC 1 cut(s) 106
BssMI GATC 2 cut(s) 241, 411
BstC8I GCNNGC 1 cut(s) 185
BstDEI CTNAG 1 cut(s) 142
BstKTI GATC 2 cut(s) 244, 414
BstMBI GATC 2 cut(s) 241, 411
BstSFI CTRYAG 1 cut(s) 274
BstV2I GAAGAC 1 cut(s) 183
BstX2I RGATCY 1 cut(s) 411
BstYI RGATCY 1 cut(s) 411
BtgZI GCGATG 1 cut(s) 236
BveI ACCTGC 1 cut(s) 106
Cac8I GCNNGC 1 cut(s) 185
Cfr13I GGNCC 2 cut(s) 44, 81
CseI GACGC 1 cut(s) 148
Csp6I GTAC 1 cut(s) 139
CviAII CATG 4 cut(s) 40, 87, 205, 402
CviJI RGCY 6 cut(s) 37, 187, 229, 249, 279, 379
CviKI_1 RGCY 6 cut(s) 37, 187, 229, 249, 279, 379
CviQI GTAC 1 cut(s) 139
DdeI CTNAG 1 cut(s) 142
DpnI GATC 2 cut(s) 243, 413
DpnII GATC 2 cut(s) 241, 411
DraI TTTAAA 1 cut(s) 348
Eco47I GGWCC 2 cut(s) 44, 81
Eco57I CTGAAG 1 cut(s) 395
EcoO109I RGGNCCY 2 cut(s) 44, 81
FaeI CATG 4 cut(s) 43, 90, 208, 405
FaiI YATR 8 cut(s) 41, 88, 167, 169, 206, 246, 296, 403
FatI CATG 4 cut(s) 39, 86, 204, 401
GsuI CTGGAG 1 cut(s) 428
HgaI GACGC 1 cut(s) 148
Hin1II CATG 4 cut(s) 43, 90, 208, 405
HinfI GANTC 1 cut(s) 316
HphI GGTGA 1 cut(s) 96
Hpy166II GTNNAC 1 cut(s) 104
Hpy188I TCNGA 1 cut(s) 174
Hpy188III TCNNGA 2 cut(s) 373, 407
Hpy8I GTNNAC 1 cut(s) 104
Hpy99I CGWCG 2 cut(s) 164, 242
HpyCH4IV ACGT 1 cut(s) 452
HpyCH4V TGCA 5 cut(s) 8, 20, 115, 135, 183
HpyF3I CTNAG 1 cut(s) 142
HpySE526I ACGT 1 cut(s) 452
Hsp92II CATG 4 cut(s) 43, 90, 208, 405
Kzo9I GATC 2 cut(s) 241, 411
LmnI GCTCC 1 cut(s) 226
LpnPI CCDG 7 cut(s) 64, 87, 101, 169, 239, 386, 392
LweI GCATC 2 cut(s) 102, 372
MaeII ACGT 1 cut(s) 452
MaeIII GTNAC 1 cut(s) 13
MalI GATC 2 cut(s) 243, 413
MboI GATC 2 cut(s) 241, 411
MboII GAAGA 2 cut(s) 158, 183
MfeI CAATTG 2 cut(s) 311, 324
MflI RGATCY 1 cut(s) 411
MluCI AATT 6 cut(s) 21, 58, 311, 324, 343, 349
MlyI GAGTC 1 cut(s) 310
MnlI CCTC 4 cut(s) 94, 281, 374, 401
MseI TTAA 2 cut(s) 347, 449
MunI CAATTG 2 cut(s) 311, 324
NdeII GATC 2 cut(s) 241, 411
NlaIII CATG 4 cut(s) 43, 90, 208, 405
NlaIV GGNNCC 3 cut(s) 45, 228, 399
PaqCI CACCTGC 1 cut(s) 106
PleI GAGTC 1 cut(s) 310
PpsI GAGTC 1 cut(s) 310
PpuMI RGGWCCY 2 cut(s) 44, 81
Psp5II RGGWCCY 2 cut(s) 44, 81
PspN4I GGNNCC 3 cut(s) 45, 228, 399
PspPI GGNCC 2 cut(s) 44, 81
PspPPI RGGWCCY 2 cut(s) 44, 81
PsrI GAACNNNNNNTAC 2 cut(s) 85, 117
PsuI RGATCY 1 cut(s) 411
RsaI GTAC 1 cut(s) 140
RsaNI GTAC 1 cut(s) 139
SaqAI TTAA 2 cut(s) 347, 449
Sau3AI GATC 2 cut(s) 241, 411
Sau96I GGNCC 2 cut(s) 44, 81
ScaI AGTACT 1 cut(s) 140
SchI GAGTC 1 cut(s) 310
SetI ASST 7 cut(s) 86, 120, 258, 273, 281, 381, 455
SfaNI GCATC 2 cut(s) 102, 372
SfcI CTRYAG 1 cut(s) 274
SinI GGWCC 2 cut(s) 44, 81
SmiI ATTTAAAT 1 cut(s) 348
SmlI CTYRAG 1 cut(s) 392
SmoI CTYRAG 1 cut(s) 392
Sse9I AATT 6 cut(s) 21, 58, 311, 324, 343, 349
SsiI CCGC 1 cut(s) 367
SwaI ATTTAAAT 1 cut(s) 348
TaiI ACGT 1 cut(s) 455
TaqI TCGA 4 cut(s) 66, 240, 333, 430
TasI AATT 6 cut(s) 21, 58, 311, 324, 343, 349
TatI WGTACW 1 cut(s) 138
Tru1I TTAA 2 cut(s) 347, 449
Tru9I TTAA 2 cut(s) 347, 449
VpaK11BI GGWCC 2 cut(s) 44, 81
XapI RAATTY 2 cut(s) 58, 349
ZrmI AGTACT 1 cut(s) 140
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.