MD10G1301900.v1.1

ADP-ribosylation factor GTPase-activating protein

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr10
Physical Location & Seq
Forward (+)
38887504 .. 38887844
341 bp
Loading structure...
UTR
Exon/CDS
Intron
MD10G1301900.v1.1.491

Sequence Viewer

Length: 129 bp
ATGGAACAGTTTTCTGAGGAGCAGAAAGGTGCTTGTACACTCAGTACACGTAACAGGACTACGCAGCAGATCAGTCGTGATCCAAAGCCCACAAGAACTTGCACAGAAACCAAAACCACAAGAACTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

43

Amino Acids

4.85

Weight (kDa)

9.38

Isoelectric Point (pI)

64.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 74
AfaI GTAC 2 cut(s) 37, 46
AflIII ACRYGT 1 cut(s) 47
AlwI GGATC 1 cut(s) 74
ApeKI GCWGC 1 cut(s) 64
BbvI GCAGC 1 cut(s) 76
BcgI CGANNNNNNTGC 2 cut(s) 56, 90
BisI GCNGC 1 cut(s) 65
BlsI GCNGC 1 cut(s) 66
BsaAI YACGTR 1 cut(s) 50
BseMII CTCAG 2 cut(s) 6, 55
BseRI GAGGAG 1 cut(s) 32
BseXI GCAGC 1 cut(s) 76
Bsp1407I TGTACA 1 cut(s) 35
Bsp143I GATC 2 cut(s) 69, 79
BspCNI CTCAG 2 cut(s) 7, 54
BspPI GGATC 1 cut(s) 74
BsrGI TGTACA 1 cut(s) 35
BssMI GATC 2 cut(s) 69, 79
Bst4CI ACNGT 1 cut(s) 9
BstAUI TGTACA 1 cut(s) 35
BstBAI YACGTR 1 cut(s) 50
BstDEI CTNAG 2 cut(s) 15, 41
BstKTI GATC 2 cut(s) 72, 82
BstMBI GATC 2 cut(s) 69, 79
BstV1I GCAGC 1 cut(s) 76
Csp6I GTAC 2 cut(s) 36, 45
CviJI RGCY 1 cut(s) 88
CviKI_1 RGCY 1 cut(s) 88
CviQI GTAC 2 cut(s) 36, 45
DdeI CTNAG 2 cut(s) 15, 41
DpnI GATC 2 cut(s) 71, 81
DpnII GATC 2 cut(s) 69, 79
Fnu4HI GCNGC 1 cut(s) 65
Fsp4HI GCNGC 1 cut(s) 65
FspEI CC 7 cut(s) 2, 12, 40, 96, 102, 103, 124
GluI GCNGC 1 cut(s) 65
Hpy166II GTNNAC 2 cut(s) 38, 47
Hpy188I TCNGA 1 cut(s) 16
Hpy188III TCNNGA 1 cut(s) 77
Hpy8I GTNNAC 2 cut(s) 38, 47
HpyCH4III ACNGT 1 cut(s) 9
HpyCH4IV ACGT 1 cut(s) 49
HpyCH4V TGCA 1 cut(s) 102
HpyF3I CTNAG 2 cut(s) 15, 41
HpySE526I ACGT 1 cut(s) 49
Kzo9I GATC 2 cut(s) 69, 79
LmnI GCTCC 1 cut(s) 19
LpnPI CCDG 1 cut(s) 40
Lsp1109I GCAGC 1 cut(s) 76
MaeII ACGT 1 cut(s) 49
MaeIII GTNAC 1 cut(s) 50
MalI GATC 2 cut(s) 71, 81
MboI GATC 2 cut(s) 69, 79
MnlI CCTC 1 cut(s) 10
NdeII GATC 2 cut(s) 69, 79
PkrI GCNGC 1 cut(s) 66
Ppu21I YACGTR 1 cut(s) 50
RsaI GTAC 2 cut(s) 37, 46
RsaNI GTAC 2 cut(s) 36, 45
SatI GCNGC 1 cut(s) 65
Sau3AI GATC 2 cut(s) 69, 79
SetI ASST 2 cut(s) 31, 52
SgeI CNNG 6 cut(s) 45, 60, 67, 89, 105, 111
TaaI ACNGT 1 cut(s) 9
TaiI ACGT 1 cut(s) 52
TatI WGTACW 2 cut(s) 35, 44
TseI GCWGC 1 cut(s) 64
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.