Rorug04G0423100

ADP-ribosylation factor GTPase-activating protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
OG0002149
Physical Location & Seq
Reverse (-)
58240054 .. 58241766
1713 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0423100.1

Sequence Viewer

Length: 366 bp
ATGGCGGAGAATACTGGTACTAATGTTAGGGTGGTGACTTCTTCAGATGAACAAGGTGATGATCGTATTCATGTCGGCCAGGAGGAAGGGGATGATCAAGATGAGGACCAGGAGGAAGAAGCTCTAAAGAAGATGATATCAGGTCATCCATTATATGGATTGTTGCTTGAGAATCACATCAACTGCTTGAAGGTGTGTTTGGGTGGTGAAATTGGTGCAATTACGGGAAGCGCTAGTACTACTACTTCTGTTACAGAAGACACTGCCAATAATAAGAAGCTCAAGGCCGCCCTTTCCAATCCTAGTTCCTCCGACCTTGATCAATTCATGGTACGAAGCATACTGCAAAGCCCTAAAGAAGCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04144 map04144
Pfam Domains
Protein Families
ArfGap

Protein Analysis

121

Amino Acids

12.98

Weight (kDa)

4.44

Isoelectric Point (pI)

51.92

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
KNOX1 PF03790 41 - 65 2.6e-06 KNOX1 domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 155
AciI CCGC 2 cut(s) 5, 288
AcoI YGGCCR 1 cut(s) 76
AcuI CTGAAG 1 cut(s) 27
AfaI GTAC 3 cut(s) 19, 238, 333
AfeI AGCGCT 1 cut(s) 232
AfiI CCNNNNNNNGG 1 cut(s) 155
AgsI TTSAA 1 cut(s) 190
AjnI CCWGG 2 cut(s) 78, 108
AjuI GAANNNNNNNTTGG 2 cut(s) 182, 214
AluBI AGCT 3 cut(s) 122, 280, 362
AluI AGCT 3 cut(s) 122, 280, 362
Aor51HI AGCGCT 1 cut(s) 232
AoxI GGCC 2 cut(s) 76, 285
AspLEI GCGC 1 cut(s) 233
AspS9I GGNCC 1 cut(s) 106
AsuHPI GGTGA 3 cut(s) 46, 68, 218
AvaII GGWCC 1 cut(s) 106
BaeI ACNNNNGTAYC 2 cut(s) 9, 42
BarI GAAGNNNNNNTAC 4 cut(s) 220, 229, 252, 261
BbsI GAAGAC 1 cut(s) 264
BciT130I CCWGG 2 cut(s) 80, 110
BclI TGATCA 2 cut(s) 94, 319
BfaI CTAG 2 cut(s) 234, 303
BfoI RGCGCY 1 cut(s) 234
BisI GCNGC 1 cut(s) 288
BlsI GCNGC 1 cut(s) 289
BmcAI AGTACT 1 cut(s) 238
Bme1390I CCNGG 2 cut(s) 80, 110
Bme18I GGWCC 1 cut(s) 106
BmgT120I GGNCC 1 cut(s) 106
BmrFI CCNGG 2 cut(s) 80, 110
BpiI GAAGAC 1 cut(s) 264
BpuEI CTTGAG 2 cut(s) 188, 266
Bsc4I CCNNNNNNNGG 1 cut(s) 155
Bse1I ACTGG 1 cut(s) 19
BseBI CCWGG 2 cut(s) 80, 110
BseGI GGATG 2 cut(s) 97, 145
BseLI CCNNNNNNNGG 1 cut(s) 155
BseNI ACTGG 1 cut(s) 19
BshFI GGCC 2 cut(s) 78, 287
BslI CCNNNNNNNGG 1 cut(s) 155
BsnI GGCC 2 cut(s) 78, 287
Bsp143I GATC 3 cut(s) 61, 94, 319
BspACI CCGC 2 cut(s) 5, 288
BspANI GGCC 2 cut(s) 78, 287
BsrI ACTGG 1 cut(s) 19
BssMI GATC 3 cut(s) 61, 94, 319
Bst2UI CCWGG 2 cut(s) 80, 110
BstF5I GGATG 2 cut(s) 97, 145
BstH2I RGCGCY 1 cut(s) 234
BstHHI GCGC 1 cut(s) 233
BstKTI GATC 3 cut(s) 64, 97, 322
BstMBI GATC 3 cut(s) 61, 94, 319
BstNI CCWGG 2 cut(s) 80, 110
BstSCI CCNGG 2 cut(s) 78, 108
BstV2I GAAGAC 1 cut(s) 264
BsuRI GGCC 2 cut(s) 78, 287
BtsCI GGATG 2 cut(s) 97, 145
BtsI GCAGTG 1 cut(s) 261
BtsIMutI CAGTG 1 cut(s) 261
CfoI GCGC 1 cut(s) 233
Cfr13I GGNCC 1 cut(s) 106
Csp6I GTAC 3 cut(s) 18, 237, 332
CviAII CATG 2 cut(s) 71, 328
CviJI RGCY 6 cut(s) 78, 122, 280, 287, 351, 362
CviKI_1 RGCY 6 cut(s) 78, 122, 280, 287, 351, 362
CviQI GTAC 3 cut(s) 18, 237, 332
DpnI GATC 3 cut(s) 63, 96, 321
DpnII GATC 3 cut(s) 61, 94, 319
EaeI YGGCCR 1 cut(s) 76
EciI GGCGGA 1 cut(s) 20
Eco32I GATATC 1 cut(s) 138
Eco47I GGWCC 1 cut(s) 106
Eco47III AGCGCT 1 cut(s) 232
Eco57I CTGAAG 1 cut(s) 27
EcoRII CCWGG 2 cut(s) 78, 108
EcoRV GATATC 1 cut(s) 138
FaeI CATG 2 cut(s) 74, 331
FaiI YATR 5 cut(s) 72, 154, 156, 329, 341
FatI CATG 2 cut(s) 70, 327
FbaI TGATCA 2 cut(s) 94, 319
Fnu4HI GCNGC 1 cut(s) 288
FokI GGATG 2 cut(s) 104, 132
Fsp4HI GCNGC 1 cut(s) 288
FspBI CTAG 2 cut(s) 234, 303
GlaI GCGC 1 cut(s) 232
GluI GCNGC 1 cut(s) 288
HaeII RGCGCY 1 cut(s) 234
HaeIII GGCC 2 cut(s) 78, 287
HhaI GCGC 1 cut(s) 233
Hin1II CATG 2 cut(s) 74, 331
Hin6I GCGC 1 cut(s) 231
HinP1I GCGC 1 cut(s) 231
HindIII AAGCTT 1 cut(s) 360
HinfI GANTC 1 cut(s) 172
HphI GGTGA 3 cut(s) 46, 68, 218
Hpy188I TCNGA 2 cut(s) 46, 313
Hpy188III TCNNGA 1 cut(s) 98
HpyAV CCTTC 2 cut(s) 80, 184
HpyCH4V TGCA 2 cut(s) 218, 346
Hsp92II CATG 2 cut(s) 74, 331
HspAI GCGC 1 cut(s) 231
Ksp22I TGATCA 2 cut(s) 94, 319
Kzo9I GATC 3 cut(s) 61, 94, 319
LpnPI CCDG 5 cut(s) 65, 92, 95, 122, 126
MaeI CTAG 2 cut(s) 234, 303
MaeIII GTNAC 2 cut(s) 34, 250
MalI GATC 3 cut(s) 63, 96, 321
MboI GATC 3 cut(s) 61, 94, 319
MboII GAAGA 4 cut(s) 33, 128, 142, 269
MluCI AATT 3 cut(s) 210, 219, 323
MmeI TCCRAC 1 cut(s) 336
MnlI CCTC 4 cut(s) 76, 97, 106, 319
MseI TTAA 1 cut(s) 364
MspR9I CCNGG 2 cut(s) 80, 110
MvaI CCWGG 2 cut(s) 80, 110
NdeII GATC 3 cut(s) 61, 94, 319
NlaIII CATG 2 cut(s) 74, 331
NmuCI GTSAC 1 cut(s) 34
PfeI GAWTC 1 cut(s) 172
PflMI CCANNNNNTGG 1 cut(s) 155
PkrI GCNGC 1 cut(s) 289
Psp6I CCWGG 2 cut(s) 78, 108
PspGI CCWGG 2 cut(s) 78, 108
PspPI GGNCC 1 cut(s) 106
RsaI GTAC 3 cut(s) 19, 238, 333
RsaNI GTAC 3 cut(s) 18, 237, 332
SaqAI TTAA 1 cut(s) 364
SatI GCNGC 1 cut(s) 288
Sau3AI GATC 3 cut(s) 61, 94, 319
Sau96I GGNCC 1 cut(s) 106
ScaI AGTACT 1 cut(s) 238
ScrFI CCNGG 2 cut(s) 80, 110
SetI ASST 7 cut(s) 58, 124, 145, 195, 282, 318, 364
SinI GGWCC 1 cut(s) 106
SmlI CTYRAG 2 cut(s) 167, 281
SmoI CTYRAG 2 cut(s) 167, 281
Sse9I AATT 3 cut(s) 210, 219, 323
SsiI CCGC 2 cut(s) 5, 288
SspMI CTAG 2 cut(s) 234, 303
StyD4I CCNGG 2 cut(s) 78, 108
TasI AATT 3 cut(s) 210, 219, 323
TatI WGTACW 1 cut(s) 236
TauI GCSGC 1 cut(s) 290
TfiI GAWTC 1 cut(s) 172
Tru1I TTAA 1 cut(s) 364
Tru9I TTAA 1 cut(s) 364
TscAI CASTG 1 cut(s) 268
TseFI GTSAC 1 cut(s) 34
Tsp45I GTSAC 1 cut(s) 34
TspDTI ATGAA 3 cut(s) 59, 63, 316
TspRI CASTG 1 cut(s) 268
Van91I CCANNNNNTGG 1 cut(s) 155
VpaK11BI GGWCC 1 cut(s) 106
XspI CTAG 2 cut(s) 234, 303
ZrmI AGTACT 1 cut(s) 238
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.