Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr11

Orthogroup ID

OG0008734

Physical Location & Seq

Genomic Coordinates Reverse (-)

4567364 .. 4569425

Gene Structure 2062 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD11G1053600.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 138 bp

ATGAAAGTTGCAGATAAAGTAAAAGCAAAAGTTTGTGAAGAGCAATATCTCTTCGGGGACGTAGGCAGGATTTTTGCCGAACCTCGTAAATTTCTTGGTGTCTTTATTTCTTGTATTTTATTATGTTCAACTGAGTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

46

Amino Acids

5.08

Weight (kDa)

7.7

Isoelectric Point (pI)

26.08

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008734)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G37510 AT2G37510
fragaria_vesca	FvH4_6g14291
malus_domestica	MD04G1122000.v1.1 MD05G1303700.v1.1 MD07G1026700.v1.1 MD11G1053600.v1.1 MD12G1138600.v1.1 MD15G1425700.v1.1 MD16G1185200.v1.1
prunus_persica	Prupe.6G250500_v2.0.a1
pyrus_communis	pycom01g12040 pycom04g11060 pycom12g13260
rosa_chinensis	RchiOBHm_Chr3g0467261
rosa_laevigata	RLG00000024513
rosa_roxburghii	Rroxscaffold_6G00413770
rosa_rugosa	Rorug03G0086300
rosa_samantha	Rh3AG134600 Rh3BG155900 Rh3CG155500 Rh3DG156700
rosa_wichuraiana	Rw3G012740

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	1 cut(s)	89
AgsI	TTSAA	1 cut(s)	129
ApoI	RAATTY	1 cut(s)	89
BseMII	CTCAG	1 cut(s)	123
BslFI	GGGAC	1 cut(s)	71
BsmFI	GGGAC	1 cut(s)	71
BspCNI	CTCAG	1 cut(s)	124
BspQI	GCTCTTC	1 cut(s)	33
Bst6I	CTCTTC	2 cut(s)	33, 56
BstDEI	CTNAG	1 cut(s)	132
DdeI	CTNAG	1 cut(s)	132
Eam1104I	CTCTTC	2 cut(s)	33, 56
EarI	CTCTTC	2 cut(s)	33, 56
FaiI	YATR	1 cut(s)	124
FaqI	GGGAC	1 cut(s)	71
FspEI	CC	8 cut(s)	39, 40, 41, 48, 52, 81, 91, 96
HpyCH4IV	ACGT	1 cut(s)	60
HpyCH4V	TGCA	1 cut(s)	11
HpyF3I	CTNAG	1 cut(s)	132
HpySE526I	ACGT	1 cut(s)	60
LguI	GCTCTTC	1 cut(s)	33
LpnPI	CCDG	1 cut(s)	52
MaeII	ACGT	1 cut(s)	60
MboII	GAAGA	2 cut(s)	43, 50
MluCI	AATT	1 cut(s)	89
MnlI	CCTC	1 cut(s)	93
PciSI	GCTCTTC	1 cut(s)	33
SapI	GCTCTTC	1 cut(s)	33
SetI	ASST	2 cut(s)	63, 85
SgeI	CNNG	5 cut(s)	67, 79, 96, 107, 123
Sse9I	AATT	1 cut(s)	89
TaiI	ACGT	1 cut(s)	63
TasI	AATT	1 cut(s)	89
TspDTI	ATGAA	1 cut(s)	17
XapI	RAATTY	1 cut(s)	89

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.