MD15G1425700.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr15
Physical Location & Seq
Forward (+)
52663162 .. 52663832
671 bp
Loading structure...
UTR
Exon/CDS
Intron
MD15G1425700.v1.1.491

Sequence Viewer

Length: 165 bp
ATGCCACACTTGCCAGTTCTTGCTTTACATATGGAAACATTGTCTGAAGAGCAATATCTCTCCGGGGACGTAGGCAGATTTTTGCCGAACCTCGTAAATTCCTCGGTGTCTTTATTTCTTGTATTTTATTATGTTCAACTGAGTGTGATTTTGGTGAGGTTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

55

Amino Acids

6.15

Weight (kDa)

5.35

Isoelectric Point (pI)

54.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 97
AcuI CTGAAG 1 cut(s) 66
AgsI TTSAA 1 cut(s) 137
ApoI RAATTY 1 cut(s) 97
AsuC2I CCSGG 1 cut(s) 64
BcnI CCSGG 1 cut(s) 64
Bme1390I CCNGG 1 cut(s) 64
BmrFI CCNGG 1 cut(s) 64
BpuMI CCSGG 1 cut(s) 64
BsaJI CCNNGG 2 cut(s) 63, 102
Bse1I ACTGG 1 cut(s) 14
BseDI CCNNGG 2 cut(s) 63, 102
BseMII CTCAG 1 cut(s) 131
BseNI ACTGG 1 cut(s) 14
BsiSI CCGG 1 cut(s) 63
BslFI GGGAC 1 cut(s) 80
BsmFI GGGAC 1 cut(s) 80
BspCNI CTCAG 1 cut(s) 132
BspQI GCTCTTC 1 cut(s) 42
BsrI ACTGG 1 cut(s) 14
BssECI CCNNGG 2 cut(s) 63, 102
Bst6I CTCTTC 1 cut(s) 42
BstDEI CTNAG 1 cut(s) 140
BstMWI GCNNNNNNNGC 1 cut(s) 10
BstSCI CCNGG 1 cut(s) 62
DdeI CTNAG 1 cut(s) 140
Eam1104I CTCTTC 1 cut(s) 42
EarI CTCTTC 1 cut(s) 42
Eco57I CTGAAG 1 cut(s) 66
FaiI YATR 3 cut(s) 30, 32, 132
FaqI GGGAC 1 cut(s) 80
FauNDI CATATG 1 cut(s) 30
HapII CCGG 1 cut(s) 63
HpaII CCGG 1 cut(s) 63
Hpy188I TCNGA 1 cut(s) 46
HpyCH4IV ACGT 1 cut(s) 69
HpyF10VI GCNNNNNNNGC 1 cut(s) 10
HpyF3I CTNAG 1 cut(s) 140
HpySE526I ACGT 1 cut(s) 69
LguI GCTCTTC 1 cut(s) 42
LpnPI CCDG 2 cut(s) 27, 76
MaeII ACGT 1 cut(s) 69
MboII GAAGA 1 cut(s) 59
MluCI AATT 1 cut(s) 97
MnlI CCTC 3 cut(s) 101, 112, 150
MspI CCGG 1 cut(s) 63
MspR9I CCNGG 1 cut(s) 64
MwoI GCNNNNNNNGC 1 cut(s) 10
NciI CCSGG 1 cut(s) 64
NdeI CATATG 1 cut(s) 30
PciSI GCTCTTC 1 cut(s) 42
SapI GCTCTTC 1 cut(s) 42
ScrFI CCNGG 1 cut(s) 64
SetI ASST 3 cut(s) 72, 93, 161
SgeI CNNG 8 cut(s) 22, 26, 32, 75, 76, 104, 115, 131
Sse9I AATT 1 cut(s) 97
StyD4I CCNGG 1 cut(s) 62
TaiI ACGT 1 cut(s) 72
TasI AATT 1 cut(s) 97
XapI RAATTY 1 cut(s) 97
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.