Rorug03G0086300

Glycine-rich RNA-binding protein

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000003
Physical Location & Seq
Reverse (-)
6662610 .. 6664582
1973 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug03G0086300.1

Sequence Viewer

Length: 168 bp
ATGCTATCTGGTCCATCACCAAATGATGTAGCCAATCGTACTTCATTTTCTGTGGTAGTCGTACAGATGCAAATGGCACATAAGGCCTGTAGTTTTCACTTTTCACCGTTGGATTGGATAGCACTTGTACCGTTGGATTGGATAGCACTTGTTTGGTGTAGCCAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

55

Amino Acids

6.13

Weight (kDa)

5.94

Isoelectric Point (pI)

46.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 3 cut(s) 40, 63, 129
AoxI GGCC 1 cut(s) 84
AspS9I GGNCC 1 cut(s) 11
AsuHPI GGTGA 2 cut(s) 9, 96
AvaII GGWCC 1 cut(s) 11
BccI CCATC 1 cut(s) 22
BfmI CTRYAG 1 cut(s) 88
Bme18I GGWCC 1 cut(s) 11
BmgT120I GGNCC 1 cut(s) 11
BmsI GCATC 1 cut(s) 57
BshFI GGCC 1 cut(s) 86
BsnI GGCC 1 cut(s) 86
BspANI GGCC 1 cut(s) 86
Bst4CI ACNGT 2 cut(s) 108, 132
BstMWI GCNNNNNNNGC 1 cut(s) 83
BstSFI CTRYAG 1 cut(s) 88
BsuRI GGCC 1 cut(s) 86
Cfr13I GGNCC 1 cut(s) 11
Csp6I GTAC 3 cut(s) 39, 62, 128
CviJI RGCY 3 cut(s) 32, 86, 162
CviKI_1 RGCY 3 cut(s) 32, 86, 162
CviQI GTAC 3 cut(s) 39, 62, 128
Eco147I AGGCCT 1 cut(s) 86
Eco47I GGWCC 1 cut(s) 11
FaiI YATR 1 cut(s) 81
HaeIII GGCC 1 cut(s) 86
HphI GGTGA 2 cut(s) 9, 96
HpyCH4III ACNGT 2 cut(s) 108, 132
HpyCH4V TGCA 1 cut(s) 70
HpyF10VI GCNNNNNNNGC 1 cut(s) 83
LpnPI CCDG 1 cut(s) 100
LweI GCATC 1 cut(s) 57
MmeI TCCRAC 2 cut(s) 90, 114
MwoI GCNNNNNNNGC 1 cut(s) 83
PceI AGGCCT 1 cut(s) 86
PspPI GGNCC 1 cut(s) 11
RsaI GTAC 3 cut(s) 40, 63, 129
RsaNI GTAC 3 cut(s) 39, 62, 128
Sau96I GGNCC 1 cut(s) 11
SfaNI GCATC 1 cut(s) 57
SfcI CTRYAG 1 cut(s) 88
SgeI CNNG 4 cut(s) 21, 99, 137, 161
SinI GGWCC 1 cut(s) 11
SseBI AGGCCT 1 cut(s) 86
StuI AGGCCT 1 cut(s) 86
TaaI ACNGT 2 cut(s) 108, 132
TspDTI ATGAA 1 cut(s) 33
VpaK11BI GGWCC 1 cut(s) 11
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.