MD13G1247600.v1.1

Lysyl-tRNA synthetase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr13
OG0005056
Physical Location & Seq
Reverse (-)
26173767 .. 26173967
201 bp
Loading structure...
UTR
Exon/CDS
Intron
MD13G1247600.v1.1.491

Sequence Viewer

Length: 201 bp
ATGACTTATCACAATGAACTTGACATGAAGCTTTTCATGCGCATTGCACCTGAACTCTACCTCAAGCAGTTTGTTGTTGGTGGCCTGGATCGTGTTTATGAGATTGGAAAACAATTTAGAAATGAGGGTATTGATTTGACTCATAATCCTGAATTCACTACCTATGAATTCTACATGGCTTATGAGACTACAATGACTTGA

Protein Analysis

67

Amino Acids

7.95

Weight (kDa)

4.92

Isoelectric Point (pI)

37.49

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
tRNA-synt_2 PF00152 3 - 63 1.2e-19 tRNA synthetases class II (D, K and N)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 41
AclWI GGATC 1 cut(s) 96
AcsI RAATTY 2 cut(s) 152, 167
AjnI CCWGG 1 cut(s) 84
AluBI AGCT 1 cut(s) 31
AluI AGCT 1 cut(s) 31
Alw26I GTCTC 1 cut(s) 179
AlwI GGATC 1 cut(s) 96
AoxI GGCC 1 cut(s) 82
ApoI RAATTY 2 cut(s) 152, 167
Asp700I GAANNNNTTC 1 cut(s) 32
AspLEI GCGC 1 cut(s) 42
BciT130I CCWGG 1 cut(s) 86
BcoDI GTCTC 1 cut(s) 179
Bme1390I CCNGG 1 cut(s) 86
BmrFI CCNGG 1 cut(s) 86
BpuEI CTTGAG 1 cut(s) 47
Bse3DI GCAATG 1 cut(s) 42
BseBI CCWGG 1 cut(s) 86
BseMI GCAATG 1 cut(s) 42
BshFI GGCC 1 cut(s) 84
BsmAI GTCTC 1 cut(s) 179
BsnI GGCC 1 cut(s) 84
Bsp143I GATC 1 cut(s) 88
BspANI GGCC 1 cut(s) 84
BspPI GGATC 1 cut(s) 96
BsrDI GCAATG 1 cut(s) 42
BssMI GATC 1 cut(s) 88
Bst2UI CCWGG 1 cut(s) 86
BstHHI GCGC 1 cut(s) 42
BstKTI GATC 1 cut(s) 91
BstMAI GTCTC 1 cut(s) 179
BstMBI GATC 1 cut(s) 88
BstMWI GCNNNNNNNGC 1 cut(s) 37
BstNI CCWGG 1 cut(s) 86
BstSCI CCNGG 1 cut(s) 84
BsuRI GGCC 1 cut(s) 84
CfoI GCGC 1 cut(s) 42
CviAII CATG 3 cut(s) 25, 37, 175
CviJI RGCY 3 cut(s) 31, 84, 179
CviKI_1 RGCY 3 cut(s) 31, 84, 179
DpnI GATC 1 cut(s) 90
DpnII GATC 1 cut(s) 88
EcoRI GAATTC 2 cut(s) 152, 167
EcoRII CCWGG 1 cut(s) 84
FaeI CATG 3 cut(s) 28, 40, 178
FaiI YATR 7 cut(s) 26, 38, 99, 144, 165, 176, 183
FatI CATG 3 cut(s) 24, 36, 174
FspAI RTGCGCAY 1 cut(s) 41
FspI TGCGCA 1 cut(s) 41
GlaI GCGC 1 cut(s) 41
HaeIII GGCC 1 cut(s) 84
HhaI GCGC 1 cut(s) 42
Hin1II CATG 3 cut(s) 28, 40, 178
Hin6I GCGC 1 cut(s) 40
HinP1I GCGC 1 cut(s) 40
HindIII AAGCTT 1 cut(s) 29
HinfI GANTC 1 cut(s) 139
Hpy188III TCNNGA 1 cut(s) 149
HpyCH4V TGCA 1 cut(s) 47
HpyF10VI GCNNNNNNNGC 1 cut(s) 37
Hsp92II CATG 3 cut(s) 28, 40, 178
HspAI GCGC 1 cut(s) 40
Kzo9I GATC 1 cut(s) 88
LpnPI CCDG 4 cut(s) 63, 71, 98, 162
MalI GATC 1 cut(s) 90
MboI GATC 1 cut(s) 88
MluCI AATT 3 cut(s) 113, 152, 167
MlyI GAGTC 1 cut(s) 133
MnlI CCTC 2 cut(s) 71, 118
MroXI GAANNNNTTC 1 cut(s) 32
MspR9I CCNGG 1 cut(s) 86
MvaI CCWGG 1 cut(s) 86
MwoI GCNNNNNNNGC 1 cut(s) 37
NdeII GATC 1 cut(s) 88
NlaIII CATG 3 cut(s) 28, 40, 178
NsbI TGCGCA 1 cut(s) 41
PdmI GAANNNNTTC 1 cut(s) 32
PleI GAGTC 1 cut(s) 133
PpsI GAGTC 1 cut(s) 133
Psp6I CCWGG 1 cut(s) 84
PspGI CCWGG 1 cut(s) 84
Sau3AI GATC 1 cut(s) 88
SchI GAGTC 1 cut(s) 133
ScrFI CCNGG 1 cut(s) 86
SetI ASST 4 cut(s) 33, 52, 63, 164
SmlI CTYRAG 1 cut(s) 62
SmoI CTYRAG 1 cut(s) 62
Sse9I AATT 3 cut(s) 113, 152, 167
StyD4I CCNGG 1 cut(s) 84
TasI AATT 3 cut(s) 113, 152, 167
TspDTI ATGAA 4 cut(s) 25, 30, 41, 180
XapI RAATTY 2 cut(s) 152, 167
XmnI GAANNNNTTC 1 cut(s) 32
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.