Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0037183.1

Orthogroup ID

OG0005056

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 1508

Gene Structure 1508 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0037183.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 642 bp

gttggggggtttgagaaggtgtacgagattggacgaatattcaggaatgaaggcatttcaactcgtcataatcctgagttcaccactatagagatgtatgaagcatattcagactatgaaagcatgatgaacatgacggaggaaattgttacacgatgtgcacttgcagttcatgggaagcttacacttgattaccagggggtggagatacatcttgagcgaccttggaggagggaaaccatgcacaatcttgtaaaagaagccactgggattactttcaatgagttaggcaatgatcttcaagttgctaaagaagttactctgaagaacctaggagctgaccttgattacaaatacaaatcttctattgaagcatgctcatctgttggccaccttcttaatgaggtttttgagattattgttgaaccaaagcttgtgcaacccacatttgttttagactatcctattgagatatctcctctggccaagccacatcggaggcatgtagggttgactgagaggtttgagctttttgtatgtggtcgtgagctggccaatgctttttctgaattgacagatcctatggatcaggtaatcatgaacattgatcggctattttcaccgcagtttttctatatttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000003 GO:0003006 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005739 GO:0007275 GO:0008150 GO:0009507 GO:0009536 GO:0009791 GO:0009908 GO:0022414 GO:0032501 GO:0032502 GO:0035670 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464 GO:0048367 GO:0048437 GO:0048438 GO:0048440 GO:0048467 GO:0048481 GO:0048608 GO:0048731 GO:0048827 GO:0048856 GO:0061458 GO:0090567 GO:0099402

KEGG Pathways

Metabolic & Signaling

ko00970 map00970

Pfam Domains

Protein Families

tRNA-synt_2 tRNA_anti-codon

Protein Analysis

213

Amino Acids

24.57

Weight (kDa)

5.04

Isoelectric Point (pI)

48.17

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005056)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G11710 AT3G30805
fragaria_vesca	FvH4_2g08732 FvH4_4g07860 FvH4_4g07860 FvH4_4g07860 FvH4_6g23270
malus_domestica	MD03G1170800.v1.1 MD13G1247500.v1.1 MD13G1247600.v1.1 MD13G1248200.v1.1 MD16G1255000.v1.1
prunus_persica	Prupe.1G082400_v2.0.a1 Prupe.1G082400_v2.0.a1 Prupe.1G083700_v2.0.a1
pyrus_communis	pycom03g12770 pycom13g21870 pycom13g21930 pycom16g21650
rosa_chinensis	RchiOBHm_Chr4g0401131
rosa_laevigata	RLG00000009161
rosa_multiflora	Rmu_sc0001909.1_g000026 Rmu_sc0037183.1_g000001
rosa_roxburghii	Rroxscaffold_5G00345980
rosa_rugosa	Rorug02G0525300 Rorug04G0028100
rosa_samantha	Rh2DG614600 Rh4BG100600 Rh4DG097900
rosa_wichuraiana	Rw4G008540

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	202
AciI	CCGC	1 cut(s)	623
AclWI	GGATC	2 cut(s)	572, 594
AcoI	YGGCCR	3 cut(s)	388, 483, 552
AcuI	CTGAAG	1 cut(s)	344
AdeI	CACNNNGTG	1 cut(s)	158
AfaI	GTAC	1 cut(s)	23
AfiI	CCNNNNNNNGG	1 cut(s)	202
AgsI	TTSAA	5 cut(s)	60, 280, 302, 371, 425
AjnI	CCWGG	1 cut(s)	195
AluBI	AGCT	5 cut(s)	181, 338, 433, 529, 550
AluI	AGCT	5 cut(s)	181, 338, 433, 529, 550
Alw21I	GWGCWC	1 cut(s)	163
Alw44I	GTGCAC	1 cut(s)	159
AlwI	GGATC	2 cut(s)	572, 594
AoxI	GGCC	3 cut(s)	388, 483, 552
ApaLI	GTGCAC	1 cut(s)	159
AspA2I	CCTAGG	1 cut(s)	331
AsuHPI	GGTGA	2 cut(s)	73, 612
AvrII	CCTAGG	1 cut(s)	331
BaeGI	GKGCMC	1 cut(s)	163
BalI	TGGCCA	3 cut(s)	390, 485, 554
Bbv12I	GWGCWC	1 cut(s)	163
BciT130I	CCWGG	1 cut(s)	197
BfaI	CTAG	1 cut(s)	332
BfmI	CTRYAG	1 cut(s)	87
BlnI	CCTAGG	1 cut(s)	331
Bme1390I	CCNGG	1 cut(s)	197
BmrFI	CCNGG	1 cut(s)	197
BmrI	ACTGGG	1 cut(s)	276
BmuI	ACTGGG	1 cut(s)	276
BpuEI	CTTGAG	1 cut(s)	236
BsaJI	CCNNGG	3 cut(s)	196, 224, 331
Bsc4I	CCNNNNNNNGG	1 cut(s)	202
Bse1I	ACTGG	1 cut(s)	271
Bse3DI	GCAATG	1 cut(s)	298
BseBI	CCWGG	1 cut(s)	197
BseDI	CCNNGG	3 cut(s)	196, 224, 331
BseLI	CCNNNNNNNGG	1 cut(s)	202
BseMI	GCAATG	1 cut(s)	298
BseMII	CTCAG	2 cut(s)	66, 507
BseNI	ACTGG	1 cut(s)	271
BseRI	GAGGAG	2 cut(s)	244, 468
BseSI	GKGCMC	1 cut(s)	163
BshFI	GGCC	3 cut(s)	390, 485, 554
BsiHKAI	GWGCWC	1 cut(s)	163
BslI	CCNNNNNNNGG	1 cut(s)	202
BsnI	GGCC	3 cut(s)	390, 485, 554
Bsp1286I	GDGCHC	1 cut(s)	163
Bsp143I	GATC	4 cut(s)	295, 577, 586, 607
BspACI	CCGC	1 cut(s)	623
BspANI	GGCC	3 cut(s)	390, 485, 554
BspCNI	CTCAG	2 cut(s)	67, 508
BspHI	TCATGA	1 cut(s)	597
BspPI	GGATC	2 cut(s)	572, 594
BsrDI	GCAATG	1 cut(s)	298
BsrI	ACTGG	1 cut(s)	271
BssECI	CCNNGG	3 cut(s)	196, 224, 331
BssMI	GATC	4 cut(s)	295, 577, 586, 607
BssT1I	CCWWGG	2 cut(s)	224, 331
Bst2UI	CCWGG	1 cut(s)	197
BstC8I	GCNNGC	2 cut(s)	376, 552
BstDEI	CTNAG	2 cut(s)	75, 516
BstKTI	GATC	4 cut(s)	298, 580, 589, 610
BstMBI	GATC	4 cut(s)	295, 577, 586, 607
BstNI	CCWGG	1 cut(s)	197
BstNSI	RCATGY	2 cut(s)	378, 506
BstSCI	CCNGG	1 cut(s)	195
BstSFI	CTRYAG	1 cut(s)	87
BstSLI	GKGCMC	1 cut(s)	163
BstX2I	RGATCY	1 cut(s)	577
BstYI	RGATCY	1 cut(s)	577
BsuRI	GGCC	3 cut(s)	390, 485, 554
BtsIMutI	CAGTG	1 cut(s)	264
Cac8I	GCNNGC	2 cut(s)	376, 552
CciI	TCATGA	1 cut(s)	597
Csp6I	GTAC	1 cut(s)	22
CviAII	CATG	7 cut(s)	124, 133, 173, 241, 375, 503, 598
CviQI	GTAC	1 cut(s)	22
DdeI	CTNAG	2 cut(s)	75, 516
DpnI	GATC	4 cut(s)	297, 579, 588, 609
DpnII	GATC	4 cut(s)	295, 577, 586, 607
DraIII	CACNNNGTG	1 cut(s)	158
EaeI	YGGCCR	3 cut(s)	388, 483, 552
Eco130I	CCWWGG	2 cut(s)	224, 331
Eco32I	GATATC	1 cut(s)	474
Eco57I	CTGAAG	1 cut(s)	344
EcoRII	CCWGG	1 cut(s)	195
EcoRV	GATATC	1 cut(s)	474
EcoT14I	CCWWGG	2 cut(s)	224, 331
ErhI	CCWWGG	2 cut(s)	224, 331
FaeI	CATG	7 cut(s)	127, 136, 176, 244, 378, 506, 601
FatI	CATG	7 cut(s)	123, 132, 172, 240, 374, 502, 597
FspBI	CTAG	1 cut(s)	332
HaeIII	GGCC	3 cut(s)	390, 485, 554
Hin1II	CATG	7 cut(s)	127, 136, 176, 244, 378, 506, 601
HincII	GTYRAC	1 cut(s)	513
HindII	GTYRAC	1 cut(s)	513
HindIII	AAGCTT	2 cut(s)	179, 431
HphI	GGTGA	2 cut(s)	73, 612
Hpy166II	GTNNAC	4 cut(s)	22, 81, 161, 513
Hpy188I	TCNGA	4 cut(s)	112, 324, 498, 568
Hpy188III	TCNNGA	5 cut(s)	43, 74, 215, 545, 598
Hpy8I	GTNNAC	4 cut(s)	22, 81, 161, 513
HpyAV	CCTTC	3 cut(s)	10, 44, 404
HpyCH4V	TGCA	4 cut(s)	161, 167, 244, 439
HpyF3I	CTNAG	2 cut(s)	75, 516
Hsp92II	CATG	7 cut(s)	127, 136, 176, 244, 378, 506, 601
Kzo9I	GATC	4 cut(s)	295, 577, 586, 607
LmnI	GCTCC	1 cut(s)	335
LpnPI	CCDG	8 cut(s)	28, 87, 182, 209, 252, 467, 536, 575
MaeI	CTAG	1 cut(s)	332
MaeIII	GTNAC	2 cut(s)	148, 316
MalI	GATC	4 cut(s)	297, 579, 588, 609
MboI	GATC	4 cut(s)	295, 577, 586, 607
MboII	GAAGA	3 cut(s)	290, 337, 354
MflI	RGATCY	1 cut(s)	577
MhlI	GDGCHC	1 cut(s)	163
MlsI	TGGCCA	3 cut(s)	390, 485, 554
MluCI	AATT	2 cut(s)	144, 569
MluNI	TGGCCA	3 cut(s)	390, 485, 554
MnlI	CCTC	7 cut(s)	133, 222, 225, 397, 489, 492, 513
Mox20I	TGGCCA	3 cut(s)	390, 485, 554
MscI	TGGCCA	3 cut(s)	390, 485, 554
MseI	TTAA	2 cut(s)	399, 640
Msp20I	TGGCCA	3 cut(s)	390, 485, 554
MspR9I	CCNGG	1 cut(s)	197
MvaI	CCWGG	1 cut(s)	197
NdeII	GATC	4 cut(s)	295, 577, 586, 607
NlaIII	CATG	7 cut(s)	127, 136, 176, 244, 378, 506, 601
NspI	RCATGY	2 cut(s)	378, 506
PaeI	GCATGC	1 cut(s)	378
PagI	TCATGA	1 cut(s)	597
PflMI	CCANNNNNTGG	1 cut(s)	202
Psp6I	CCWGG	1 cut(s)	195
PspGI	CCWGG	1 cut(s)	195
PsuI	RGATCY	1 cut(s)	577
RsaI	GTAC	1 cut(s)	23
RsaNI	GTAC	1 cut(s)	22
SaqAI	TTAA	2 cut(s)	399, 640
Sau3AI	GATC	4 cut(s)	295, 577, 586, 607
ScrFI	CCNGG	1 cut(s)	197
SduI	GDGCHC	1 cut(s)	163
SfcI	CTRYAG	1 cut(s)	87
SmlI	CTYRAG	1 cut(s)	215
SmoI	CTYRAG	1 cut(s)	215
SphI	GCATGC	1 cut(s)	378
Sse9I	AATT	2 cut(s)	144, 569
SsiI	CCGC	1 cut(s)	623
SspI	AATATT	1 cut(s)	39
SspMI	CTAG	1 cut(s)	332
StyD4I	CCNGG	1 cut(s)	195
StyI	CCWWGG	2 cut(s)	224, 331
TasI	AATT	2 cut(s)	144, 569
Tru1I	TTAA	2 cut(s)	399, 640
Tru9I	TTAA	2 cut(s)	399, 640
TscAI	CASTG	1 cut(s)	271
TspDTI	ATGAA	6 cut(s)	63, 114, 132, 143, 161, 614
TspGWI	ACGGA	1 cut(s)	152
TspRI	CASTG	1 cut(s)	271
Van91I	CCANNNNNTGG	1 cut(s)	202
VneI	GTGCAC	1 cut(s)	159
XceI	RCATGY	2 cut(s)	378, 506
XmaJI	CCTAGG	1 cut(s)	331
XspI	CTAG	1 cut(s)	332

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.