Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr14

Orthogroup ID

OG0006369

Physical Location & Seq

Genomic Coordinates Forward (+)

16507780 .. 16507967

Gene Structure 188 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD14G1106300.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 171 bp

ATGTTGGCTGGTGTAGGATGGACAATGCAGGATTACTTGAAACATGGGAAGAATGATTACTACCCACCTCTTGCAAATGGTCATAGGCTTTTCCTTCATGACATTAGACGAGTAGCTATCTGTTGTGCCGTTGCAATGGGCGAGGAAGGGGATATGGTTGTAAGTTTCTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0006996 GO:0008150 GO:0009295 GO:0009507 GO:0009536 GO:0009657 GO:0009658 GO:0009987 GO:0010020 GO:0010468 GO:0016043 GO:0019222 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043572 GO:0044424 GO:0044444 GO:0044464 GO:0048285 GO:0050789 GO:0060255 GO:0065007 GO:0071840

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Mur_ligase Mur_ligase_C Mur_ligase_M

Protein Analysis

57

Amino Acids

6.3

Weight (kDa)

6.23

Isoelectric Point (pI)

24.9

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006369)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G63680 AT1G63680 AT1G63680
fragaria_vesca	FvH4_5g02610 FvH4_5g02610 FvH4_5g02610 FvH4_5g02610
malus_domestica	MD06G1085100.v1.1 MD14G1106100.v1.1 MD14G1106300.v1.1
prunus_persica	Prupe.5G101100_v2.0.a1
pyrus_communis	pycom06g08120
rosa_chinensis	RchiOBHm_Chr7g0197491
rosa_laevigata	RLG00000003936 RLG00000003970
rosa_multiflora	Rmu_co8124254.1_g000001 Rmu_co8184758.1_g000001 Rmu_sc0002167.1_g000003 Rmu_sc0013361.1_g000005
rosa_roxburghii	Rroxscaffold_3G00258420
rosa_rugosa	Rorug07G0040000 Rorug07G0040100
rosa_samantha	Rh7AG165200 Rh7BG167300 Rh7CG173700 Rh7DG166600
rosa_wichuraiana	Rw7G014400

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AgsI	TTSAA	1 cut(s)	40
AluBI	AGCT	1 cut(s)	116
AluI	AGCT	1 cut(s)	116
BarI	GAAGNNNNNNTAC	2 cut(s)	41, 73
BccI	CCATC	1 cut(s)	12
BceAI	ACGGC	1 cut(s)	113
Bse3DI	GCAATG	1 cut(s)	141
BseGI	GGATG	1 cut(s)	23
BseMI	GCAATG	1 cut(s)	141
BspHI	TCATGA	1 cut(s)	97
BsrDI	GCAATG	1 cut(s)	141
BstF5I	GGATG	1 cut(s)	23
BtsCI	GGATG	1 cut(s)	23
CciI	TCATGA	1 cut(s)	97
CviAII	CATG	2 cut(s)	44, 98
CviJI	RGCY	3 cut(s)	8, 88, 116
CviKI_1	RGCY	3 cut(s)	8, 88, 116
FaeI	CATG	2 cut(s)	47, 101
FaiI	YATR	4 cut(s)	45, 84, 99, 155
FatI	CATG	2 cut(s)	43, 97
FokI	GGATG	1 cut(s)	30
Hin1II	CATG	2 cut(s)	47, 101
Hpy188I	TCNGA	1 cut(s)	170
Hpy188III	TCNNGA	1 cut(s)	98
HpyAV	CCTTC	2 cut(s)	104, 140
HpyCH4V	TGCA	3 cut(s)	28, 74, 134
Hsp92II	CATG	2 cut(s)	47, 101
LpnPI	CCDG	1 cut(s)	14
MboII	GAAGA	1 cut(s)	61
MnlI	CCTC	2 cut(s)	78, 136
NlaIII	CATG	2 cut(s)	47, 101
PagI	TCATGA	1 cut(s)	97
SetI	ASST	2 cut(s)	70, 118
SgeI	CNNG	8 cut(s)	21, 41, 49, 56, 83, 110, 122, 154
TspDTI	ATGAA	1 cut(s)	86

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.