Rmu_co8184758.1_g000001

UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8184758.1
Physical Location & Seq
Reverse (-)
1 .. 605
605 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8184758.1_g000001.1.cds

Sequence Viewer

Length: 252 bp
atgatggcgaagattgcaacagataaaagtgatgtgacaatactgacatctgacaatccaaagaatgaagatccattggacatcttggatgatatgctggctggtataggatggacaatgcaggaatacttgaaacatggcgagaatgattactacccacctcttccaaatggtcataggattttcctgcatgatataagacgagtagccgtacggtgtgctgttgccatgggtgaggaaggtgatatggtt

Protein Analysis

84

Amino Acids

9.46

Weight (kDa)

4.63

Isoelectric Point (pI)

26.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 65
AfaI GTAC 1 cut(s) 213
AgsI TTSAA 1 cut(s) 133
AlwI GGATC 1 cut(s) 65
AsuHPI GGTGA 1 cut(s) 245
BccI CCATC 1 cut(s) 105
BceAI ACGGC 1 cut(s) 194
BsaJI CCNNGG 1 cut(s) 228
BseDI CCNNGG 1 cut(s) 228
BseGI GGATG 2 cut(s) 94, 116
BsiWI CGTACG 1 cut(s) 211
Bsp143I GATC 1 cut(s) 70
Bsp19I CCATGG 1 cut(s) 228
BspPI GGATC 1 cut(s) 65
BssECI CCNNGG 1 cut(s) 228
BssMI GATC 1 cut(s) 70
BssT1I CCWWGG 1 cut(s) 228
Bst4CI ACNGT 1 cut(s) 216
Bst6I CTCTTC 1 cut(s) 168
BstC8I GCNNGC 1 cut(s) 99
BstDSI CCRYGG 1 cut(s) 228
BstF5I GGATG 2 cut(s) 94, 116
BstKTI GATC 1 cut(s) 73
BstMBI GATC 1 cut(s) 70
BstMWI GCNNNNNNNGC 1 cut(s) 14
BstX2I RGATCY 1 cut(s) 70
BstYI RGATCY 1 cut(s) 70
BtgI CCRYGG 1 cut(s) 228
BtsCI GGATG 2 cut(s) 94, 116
Cac8I GCNNGC 1 cut(s) 99
Csp6I GTAC 1 cut(s) 212
CviAII CATG 3 cut(s) 137, 191, 229
CviJI RGCY 2 cut(s) 101, 209
CviKI_1 RGCY 2 cut(s) 101, 209
CviQI GTAC 1 cut(s) 212
DpnI GATC 1 cut(s) 72
DpnII GATC 1 cut(s) 70
Eam1104I CTCTTC 1 cut(s) 168
EarI CTCTTC 1 cut(s) 168
Eco130I CCWWGG 1 cut(s) 228
EcoT14I CCWWGG 1 cut(s) 228
ErhI CCWWGG 1 cut(s) 228
FaeI CATG 3 cut(s) 140, 194, 232
FaiI YATR 8 cut(s) 95, 107, 138, 177, 192, 197, 230, 248
FatI CATG 3 cut(s) 136, 190, 228
FokI GGATG 2 cut(s) 101, 123
Hin1II CATG 3 cut(s) 140, 194, 232
HphI GGTGA 1 cut(s) 245
Hpy188I TCNGA 1 cut(s) 52
HpyAV CCTTC 1 cut(s) 233
HpyCH4III ACNGT 1 cut(s) 216
HpyCH4V TGCA 3 cut(s) 17, 121, 190
HpyF10VI GCNNNNNNNGC 1 cut(s) 14
Hsp92II CATG 3 cut(s) 140, 194, 232
Kzo9I GATC 1 cut(s) 70
LpnPI CCDG 4 cut(s) 83, 87, 107, 200
MaeIII GTNAC 1 cut(s) 34
MalI GATC 1 cut(s) 72
MboI GATC 1 cut(s) 70
MboII GAAGA 3 cut(s) 22, 80, 155
MflI RGATCY 1 cut(s) 70
MnlI CCTC 2 cut(s) 171, 229
MwoI GCNNNNNNNGC 1 cut(s) 14
NcoI CCATGG 1 cut(s) 228
NdeII GATC 1 cut(s) 70
NlaIII CATG 3 cut(s) 140, 194, 232
NmuCI GTSAC 1 cut(s) 34
Pfl23II CGTACG 1 cut(s) 211
PspLI CGTACG 1 cut(s) 211
PsuI RGATCY 1 cut(s) 70
RsaI GTAC 1 cut(s) 213
RsaNI GTAC 1 cut(s) 212
Sau3AI GATC 1 cut(s) 70
SetI ASST 2 cut(s) 163, 244
StyI CCWWGG 1 cut(s) 228
TaaI ACNGT 1 cut(s) 216
TseFI GTSAC 1 cut(s) 34
Tsp45I GTSAC 1 cut(s) 34
TspDTI ATGAA 1 cut(s) 81
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.