Rmu_co8124254.1_g000001

UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8124254.1
Physical Location & Seq
Forward (+)
1 .. 623
623 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8124254.1_g000001.1.cds

Sequence Viewer

Length: 623 bp
ctaaaaccccaattcgcctctctccgaccctccagcttccctctcccggcccgcccactcaaacccgcccacgcaatcggccccgacggcaagtactacccggacccctccgacgacgacccgcccgaagcccccgaagactccggccacggcgtctccaaattccagcaaatccagcgccaggcctcccgccaccagaagctccaggaggacgacttcaagaagcaccagaacaccatgctctccgccattgccgacgtcgaggacccgccggagaaccccggctccggaactacccccagctccggggacgatttgttcggcgacatcgacgaagctattgccttgaagcgcaaggagtttgtgaagcaagggcttttgaagccgaaccctaaggtggaggcggtggaggagctggagctggagccggacgaggtggtggacttggaggagattgatgaacttcaggggctggcgattgtgggtgaggattcggatgaggaagggactgagaaattcgactcaaaggttagtgatttggatgagaaagatggtgtttcggtttcgagttctttgtttgatatggattttgataattatggtaagactagggctagaattgt

Protein Analysis

208

Amino Acids

22.89

Weight (kDa)

4.37

Isoelectric Point (pI)

43.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 261
AccIII TCCGGA 1 cut(s) 287
AciI CCGC 7 cut(s) 52, 66, 122, 190, 246, 269, 404
AcoI YGGCCR 1 cut(s) 145
AcsI RAATTY 2 cut(s) 161, 515
AcuI CTGAAG 1 cut(s) 449
AcyI GRCGYC 2 cut(s) 153, 258
AfaI GTAC 1 cut(s) 95
AfiI CCNNNNNNNGG 6 cut(s) 46, 181, 287, 305, 306, 397
AgsI TTSAA 3 cut(s) 220, 349, 382
AjnI CCWGG 2 cut(s) 180, 204
AloI GAACNNNNNNTCC 4 cut(s) 269, 301, 302, 334
AluBI AGCT 6 cut(s) 36, 202, 303, 338, 415, 421
AluI AGCT 6 cut(s) 36, 202, 303, 338, 415, 421
Alw26I GTCTC 1 cut(s) 160
AlwNI CAGNNNCTG 1 cut(s) 472
Aor13HI TCCGGA 1 cut(s) 287
AoxI GGCC 4 cut(s) 48, 79, 145, 183
ApoI RAATTY 2 cut(s) 161, 515
ArsI GACNNNNNNTTYG 2 cut(s) 302, 334
AspLEI GCGC 2 cut(s) 180, 354
AspS9I GGNCC 4 cut(s) 49, 80, 103, 265
AsuC2I CCSGG 4 cut(s) 47, 101, 282, 307
AsuHPI GGTGA 1 cut(s) 497
AvaII GGWCC 2 cut(s) 103, 265
AxyI CCTNAGG 1 cut(s) 393
BbsI GAAGAC 1 cut(s) 144
BccI CCATC 1 cut(s) 545
BceAI ACGGC 2 cut(s) 103, 166
BcgI CGANNNNNNTGC 2 cut(s) 323, 357
BciT130I CCWGG 2 cut(s) 182, 206
BcnI CCSGG 4 cut(s) 47, 101, 282, 307
BcoDI GTCTC 1 cut(s) 160
BfaI CTAG 2 cut(s) 609, 615
BfoI RGCGCY 1 cut(s) 181
BglI GCCNNNNNGGC 1 cut(s) 87
BmcAI AGTACT 1 cut(s) 95
Bme1390I CCNGG 6 cut(s) 47, 101, 182, 206, 282, 307
Bme18I GGWCC 2 cut(s) 103, 265
BmgT120I GGNCC 4 cut(s) 49, 80, 103, 265
BmiI GGNNCC 5 cut(s) 82, 105, 267, 286, 426
BmrFI CCNGG 6 cut(s) 47, 101, 182, 206, 282, 307
BpiI GAAGAC 1 cut(s) 144
BpmI CTGGAG 4 cut(s) 16, 188, 437, 443
BpuMI CCSGG 4 cut(s) 47, 101, 282, 307
BsaHI GRCGYC 2 cut(s) 153, 258
BsaJI CCNNGG 3 cut(s) 148, 280, 306
BsaWI WCCGGW 1 cut(s) 287
BsaXI ACNNNNNCTCC 4 cut(s) 140, 170, 269, 299
Bsc4I CCNNNNNNNGG 6 cut(s) 46, 181, 287, 305, 306, 397
Bse21I CCTNAGG 1 cut(s) 393
Bse3DI GCAATG 1 cut(s) 249
BseAI TCCGGA 1 cut(s) 287
BseBI CCWGG 2 cut(s) 182, 206
BseDI CCNNGG 3 cut(s) 148, 280, 306
BseGI GGATG 2 cut(s) 502, 547
BseLI CCNNNNNNNGG 6 cut(s) 46, 181, 287, 305, 306, 397
BseMI GCAATG 1 cut(s) 249
BseMII CTCAG 1 cut(s) 501
BseRI GAGGAG 2 cut(s) 425, 464
BseYI CCCAGC 1 cut(s) 299
BshFI GGCC 4 cut(s) 50, 81, 147, 185
BsiSI CCGG 8 cut(s) 47, 101, 144, 272, 282, 288, 306, 428
BslFI GGGAC 2 cut(s) 323, 520
BslI CCNNNNNNNGG 6 cut(s) 46, 181, 287, 305, 306, 397
BsmAI GTCTC 1 cut(s) 160
BsmBI CGTCTC 1 cut(s) 160
BsmFI GGGAC 2 cut(s) 323, 520
BsnI GGCC 4 cut(s) 50, 81, 147, 185
Bsp13I TCCGGA 1 cut(s) 287
BspACI CCGC 7 cut(s) 52, 66, 122, 190, 246, 269, 404
BspANI GGCC 4 cut(s) 50, 81, 147, 185
BspCNI CTCAG 1 cut(s) 502
BspEI TCCGGA 1 cut(s) 287
BspLI GGNNCC 5 cut(s) 82, 105, 267, 286, 426
BsrDI GCAATG 1 cut(s) 249
BssECI CCNNGG 3 cut(s) 148, 280, 306
BssNI GRCGYC 2 cut(s) 153, 258
Bst2UI CCWGG 2 cut(s) 182, 206
BstACI GRCGYC 2 cut(s) 153, 258
BstC8I GCNNGC 2 cut(s) 52, 474
BstDEI CTNAG 2 cut(s) 393, 510
BstDSI CCRYGG 1 cut(s) 148
BstF5I GGATG 2 cut(s) 502, 547
BstH2I RGCGCY 1 cut(s) 181
BstHHI GCGC 2 cut(s) 180, 354
BstMAI GTCTC 1 cut(s) 160
BstMWI GCNNNNNNNGC 3 cut(s) 87, 175, 382
BstNI CCWGG 2 cut(s) 182, 206
BstSCI CCNGG 6 cut(s) 45, 99, 180, 204, 280, 305
BstV2I GAAGAC 1 cut(s) 144
Bsu36I CCTNAGG 1 cut(s) 393
BsuRI GGCC 4 cut(s) 50, 81, 147, 185
BtgI CCRYGG 1 cut(s) 148
BtsCI GGATG 2 cut(s) 502, 547
Cac8I GCNNGC 2 cut(s) 52, 474
CaiI CAGNNNCTG 1 cut(s) 472
CfoI GCGC 2 cut(s) 180, 354
Cfr13I GGNCC 4 cut(s) 49, 80, 103, 265
CseI GACGC 1 cut(s) 142
Csp6I GTAC 1 cut(s) 94
CviAII CATG 1 cut(s) 238
CviQI GTAC 1 cut(s) 94
DdeI CTNAG 2 cut(s) 393, 510
EaeI YGGCCR 1 cut(s) 145
EciI GGCGGA 1 cut(s) 235
Eco147I AGGCCT 1 cut(s) 185
Eco47I GGWCC 2 cut(s) 103, 265
Eco57I CTGAAG 1 cut(s) 449
Eco81I CCTNAGG 1 cut(s) 393
EcoO109I RGGNCCY 1 cut(s) 265
EcoRII CCWGG 2 cut(s) 180, 204
Esp3I CGTCTC 1 cut(s) 160
FaeI CATG 1 cut(s) 241
FaiI YATR 3 cut(s) 239, 584, 600
FaqI GGGAC 2 cut(s) 323, 520
FatI CATG 1 cut(s) 237
FauI CCCGC 5 cut(s) 59, 73, 129, 197, 276
FokI GGATG 2 cut(s) 509, 554
FspBI CTAG 2 cut(s) 609, 615
GlaI GCGC 2 cut(s) 179, 353
GsaI CCCAGC 1 cut(s) 303
GsuI CTGGAG 4 cut(s) 16, 188, 437, 443
HaeII RGCGCY 1 cut(s) 181
HaeIII GGCC 4 cut(s) 50, 81, 147, 185
HapII CCGG 8 cut(s) 47, 101, 144, 272, 282, 288, 306, 428
HgaI GACGC 1 cut(s) 142
HhaI GCGC 2 cut(s) 180, 354
Hin1I GRCGYC 2 cut(s) 153, 258
Hin1II CATG 1 cut(s) 241
Hin6I GCGC 2 cut(s) 178, 352
HinP1I GCGC 2 cut(s) 178, 352
HinfI GANTC 3 cut(s) 140, 491, 521
HpaII CCGG 8 cut(s) 47, 101, 144, 272, 282, 288, 306, 428
HphI GGTGA 1 cut(s) 497
Hpy166II GTNNAC 1 cut(s) 442
Hpy188I TCNGA 3 cut(s) 26, 112, 496
Hpy188III TCNNGA 2 cut(s) 220, 288
Hpy8I GTNNAC 1 cut(s) 442
Hpy99I CGWCG 6 cut(s) 89, 116, 119, 260, 263, 335
HpyAV CCTTC 1 cut(s) 497
HpyCH4IV ACGT 1 cut(s) 258
HpyF10VI GCNNNNNNNGC 3 cut(s) 87, 175, 382
HpyF3I CTNAG 2 cut(s) 393, 510
HpySE526I ACGT 1 cut(s) 258
Hsp92I GRCGYC 2 cut(s) 153, 258
Hsp92II CATG 1 cut(s) 241
HspAI GCGC 2 cut(s) 178, 352
Kpn2I TCCGGA 1 cut(s) 287
LmnI GCTCC 6 cut(s) 207, 290, 308, 412, 418, 424
MaeI CTAG 2 cut(s) 609, 615
MaeII ACGT 1 cut(s) 258
MboII GAAGA 1 cut(s) 149
MluCI AATT 5 cut(s) 11, 161, 515, 595, 618
MlyI GAGTC 2 cut(s) 134, 515
MmeI TCCRAC 2 cut(s) 49, 135
MroI TCCGGA 1 cut(s) 287
MspI CCGG 8 cut(s) 47, 101, 144, 272, 282, 288, 306, 428
MspR9I CCNGG 6 cut(s) 47, 101, 182, 206, 282, 307
MvaI CCWGG 2 cut(s) 182, 206
MwoI GCNNNNNNNGC 3 cut(s) 87, 175, 382
NciI CCSGG 4 cut(s) 47, 101, 282, 307
NlaIII CATG 1 cut(s) 241
NlaIV GGNNCC 5 cut(s) 82, 105, 267, 286, 426
PceI AGGCCT 1 cut(s) 185
PcsI WCGNNNNNNNCGW 2 cut(s) 123, 327
PfeI GAWTC 1 cut(s) 491
PfoI TCCNGGA 1 cut(s) 204
PleI GAGTC 2 cut(s) 134, 515
PpsI GAGTC 2 cut(s) 134, 515
PpuMI RGGWCCY 1 cut(s) 265
Psp5II RGGWCCY 1 cut(s) 265
Psp6I CCWGG 2 cut(s) 180, 204
PspFI CCCAGC 1 cut(s) 299
PspGI CCWGG 2 cut(s) 180, 204
PspN4I GGNNCC 5 cut(s) 82, 105, 267, 286, 426
PspPI GGNCC 4 cut(s) 49, 80, 103, 265
PspPPI RGGWCCY 1 cut(s) 265
PstNI CAGNNNCTG 1 cut(s) 472
RsaI GTAC 1 cut(s) 95
RsaNI GTAC 1 cut(s) 94
Sau96I GGNCC 4 cut(s) 49, 80, 103, 265
ScaI AGTACT 1 cut(s) 95
SchI GAGTC 2 cut(s) 134, 515
ScrFI CCNGG 6 cut(s) 47, 101, 182, 206, 282, 307
SinI GGWCC 2 cut(s) 103, 265
Sse9I AATT 5 cut(s) 11, 161, 515, 595, 618
SseBI AGGCCT 1 cut(s) 185
SsiI CCGC 7 cut(s) 52, 66, 122, 190, 246, 269, 404
SspMI CTAG 2 cut(s) 609, 615
StuI AGGCCT 1 cut(s) 185
StyD4I CCNGG 6 cut(s) 45, 99, 180, 204, 280, 305
TaiI ACGT 1 cut(s) 261
TaqI TCGA 4 cut(s) 261, 330, 519, 566
TasI AATT 5 cut(s) 11, 161, 515, 595, 618
TatI WGTACW 1 cut(s) 93
TfiI GAWTC 1 cut(s) 491
TspDTI ATGAA 1 cut(s) 474
VpaK11BI GGWCC 2 cut(s) 103, 265
XapI RAATTY 2 cut(s) 161, 515
XspI CTAG 2 cut(s) 609, 615
ZraI GACGTC 1 cut(s) 259
ZrmI AGTACT 1 cut(s) 95
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.