Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr15

Orthogroup ID

OG0004438

Physical Location & Seq

Genomic Coordinates Forward (+)

3573396 .. 3577268

Gene Structure 3873 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD15G1052000.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1053 bp

ATGGGTGAGGCGGTTGAGTTTTTCCATACAAATGGTAATGGTTTCTGCAAGTTCAGTGAAAAATTTGATCCTAAAACCGTAGTAATACTTAACGGTAGCAACCACGTAGAGAGAGATAGAGATAGTTCCTGGTACGAAGAAACCATCGACGACGACCTCAAATGGTCATTTGCTCTCAATGTCAACGGTGTGCTGCATAAAGGGACTAGCGAGTATCAGGAGATAGCTTTATTGGACACAAGGCGTTTCGGGAAGGTGTTGGTGATTGATGGGAAGATGCAAAGTGCAGAAGTGGATGAATTTATATATCATGAGTGCTTGATACATCCTGCACTCTTATGTCACCCAAAGCCTAAAAATGTATTCATAATGGGAGGTGGGGAAGGGTCAGCTGCAAGGGAAGCACTCAAGCACAAATTGCTGGACAAAGTTACCATGTGTGATATCGATCAGGAGGTGGTTGATTTCTGCCGCAGGCATTTGACAATGAATCAGGAGGCATTTTCTCACCATAAGCTGAACCTTGTGATTAATGATGCCAAGACTGAATTGGAGAAGAGTTGTGAAAAATTCGATATCATAGTGGGAGATTTAGCAGACCCAGTTGAAGGAGGACCTTGCTATCAACTCTACACAAAATCCTTCTATGAGAAAATTCTTAAACCTAAGCTTAATCATGGTGGCATTTTTGTGACCCAGGCTGGTCCAGCAGGCATTTTTACCCACAAAGAGGTCTTCACCTCTATATACAACACAATTAAACAGGTCTTCAAGTATGTGGTGCCATATGCAGCTCACATACCATCTTTTGCAGATACATGGGGATGGGTTATGGCCTCCGATGAACCGTTCTCTATCAATGGTGAGAAAATGGACAGAAGAATTGAAGAAAGAATTGATGGGGAGCTAAACTATCTGAATGGTGCTCTGTTCATCTCCTCTGCTACCATGAACAAAACCGTTTCCTTATCGTTGCTGAATGAAACTCATGTCTACACTGAGGAAGATGCTAGATTTATTCATGGACGTGGGGTGGCTTGCCGCATTAACTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0006810 GO:0008150 GO:0009888 GO:0009914 GO:0009926 GO:0009987 GO:0010087 GO:0010089 GO:0010487 GO:0010817 GO:0016740 GO:0016765 GO:0016768 GO:0030154 GO:0032502 GO:0044424 GO:0044464 GO:0048759 GO:0048856 GO:0048869 GO:0051179 GO:0051234 GO:0060918 GO:0065007 GO:0065008 GO:1905177

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Spermine_synt_N Spermine_synth

Protein Analysis

351

Amino Acids

39.64

Weight (kDa)

5.61

Isoelectric Point (pI)

32.31

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Spermine_synt_N	PF17284	44 - 97	2.4e-12	Spermidine synthase tetramerisation domain
Spermine_synth	PF01564	100 - 281	1.7e-44	Spermine/spermidine synthase domain

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004438)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G19530 AT5G19530
fragaria_vesca	FvH4_1g08290 FvH4_1g08290 FvH4_1g08290 FvH4_2g31200 FvH4_2g31200
malus_domestica	MD08G1070200.v1.1 MD15G1052000.v1.1
prunus_persica	Prupe.1G405900_v2.0.a1 Prupe.1G405900_v2.0.a1 Prupe.7G202400_v2.0.a1 Prupe.7G202400_v2.0.a1
pyrus_communis	pycom08g05810 pycom15g04970
rosa_chinensis	RchiOBHm_Chr2g0094361 RchiOBHm_Chr6g0311611
rosa_laevigata	RLG00000010387
rosa_multiflora	Rmu_sc0002888.1_g000005 Rmu_sc0015881.1_g000007
rosa_roxburghii	Rroxscaffold_2G00147190 Rroxscaffold_7G00157440
rosa_rugosa	Rorug02G0043600 Rorug06G0390100
rosa_samantha	Rh2AG091400 Rh2BG091400 Rh2DG090200 Rh6AG505300 Rh6BG516000 Rh6CG522000 Rh6DG507700
rosa_wichuraiana	Rw6G043980

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	781
AccI	GTMKAC	1 cut(s)	993
AciI	CCGC	3 cut(s)	11, 472, 1042
AclWI	GGATC	1 cut(s)	62
AcsI	RAATTY	4 cut(s)	62, 299, 569, 654
AfaI	GTAC	1 cut(s)	134
AfiI	CCNNNNNNNGG	2 cut(s)	608, 730
AgsI	TTSAA	3 cut(s)	608, 772, 887
AjiI	CACGTC	1 cut(s)	1028
AjnI	CCWGG	2 cut(s)	128, 696
AluBI	AGCT	6 cut(s)	227, 392, 517, 670, 794, 907
AluI	AGCT	6 cut(s)	227, 392, 517, 670, 794, 907
Alw21I	GWGCWC	1 cut(s)	928
AlwI	GGATC	1 cut(s)	62
AoxI	GGCC	1 cut(s)	834
ApeKI	GCWGC	3 cut(s)	193, 392, 791
ApoI	RAATTY	4 cut(s)	62, 299, 569, 654
AseI	ATTAAT	1 cut(s)	531
AspS9I	GGNCC	2 cut(s)	614, 704
AsuHPI	GGTGA	6 cut(s)	17, 274, 335, 500, 730, 875
AvaII	GGWCC	2 cut(s)	614, 704
BanI	GGYRCC	1 cut(s)	781
BbsI	GAAGAC	2 cut(s)	727, 760
Bbv12I	GWGCWC	1 cut(s)	928
BbvI	GCAGC	3 cut(s)	180, 379, 803
BccI	CCATC	5 cut(s)	152, 263, 811, 819, 893
BciT130I	CCWGG	2 cut(s)	130, 698
BfaI	CTAG	2 cut(s)	207, 1011
BisI	GCNGC	5 cut(s)	194, 393, 472, 792, 1042
BlsI	GCNGC	5 cut(s)	195, 394, 473, 793, 1043
Bme1390I	CCNGG	2 cut(s)	130, 698
Bme18I	GGWCC	2 cut(s)	614, 704
BmgBI	CACGTC	1 cut(s)	1028
BmgT120I	GGNCC	2 cut(s)	614, 704
BmiI	GGNNCC	1 cut(s)	783
BmrFI	CCNGG	2 cut(s)	130, 698
BmrI	ACTGGG	1 cut(s)	596
BmsI	GCATC	3 cut(s)	267, 526, 997
BmuI	ACTGGG	1 cut(s)	596
BpiI	GAAGAC	2 cut(s)	727, 760
Bpu10I	CCTNAGC	1 cut(s)	666
BpuEI	CTTGAG	1 cut(s)	392
Bsa29I	ATCGAT	1 cut(s)	447
BsaAI	YACGTR	1 cut(s)	106
BsaBI	GATNNNNATC	1 cut(s)	447
BsaJI	CCNNGG	1 cut(s)	696
Bsc4I	CCNNNNNNNGG	2 cut(s)	608, 730
Bse1I	ACTGG	1 cut(s)	602
Bse8I	GATNNNNATC	1 cut(s)	447
BseBI	CCWGG	2 cut(s)	130, 698
BseCI	ATCGAT	1 cut(s)	447
BseDI	CCNNGG	1 cut(s)	696
BseGI	GGATG	3 cut(s)	301, 325, 830
BseJI	GATNNNNATC	1 cut(s)	447
BseLI	CCNNNNNNNGG	2 cut(s)	608, 730
BseMII	CTCAG	1 cut(s)	990
BseNI	ACTGG	1 cut(s)	602
BseRI	GAGGAG	1 cut(s)	928
BseXI	GCAGC	3 cut(s)	180, 379, 803
BsgI	GTGCAG	2 cut(s)	306, 315
BshFI	GGCC	1 cut(s)	836
BshNI	GGYRCC	1 cut(s)	781
BshVI	ATCGAT	1 cut(s)	447
BsiHKAI	GWGCWC	1 cut(s)	928
BslFI	GGGAC	1 cut(s)	217
BslI	CCNNNNNNNGG	2 cut(s)	608, 730
BsmFI	GGGAC	1 cut(s)	217
BsnI	GGCC	1 cut(s)	836
Bsp1286I	GDGCHC	1 cut(s)	928
Bsp143I	GATC	2 cut(s)	67, 448
BspACI	CCGC	3 cut(s)	11, 472, 1042
BspANI	GGCC	1 cut(s)	836
BspCNI	CTCAG	1 cut(s)	991
BspDI	ATCGAT	1 cut(s)	447
BspHI	TCATGA	1 cut(s)	310
BspLI	GGNNCC	1 cut(s)	783
BspPI	GGATC	1 cut(s)	62
BspT107I	GGYRCC	1 cut(s)	781
BsrI	ACTGG	1 cut(s)	602
BssECI	CCNNGG	1 cut(s)	696
BssMI	GATC	2 cut(s)	67, 448
Bst2UI	CCWGG	2 cut(s)	130, 698
Bst4CI	ACNGT	5 cut(s)	79, 95, 188, 849, 961
Bst6I	CTCTTC	1 cut(s)	551
BstAPI	GCANNNNNTGC	1 cut(s)	418
BstBAI	YACGTR	1 cut(s)	106
BstC8I	GCNNGC	3 cut(s)	476, 712, 1039
BstDEI	CTNAG	2 cut(s)	666, 999
BstF5I	GGATG	3 cut(s)	301, 325, 830
BstKTI	GATC	2 cut(s)	70, 451
BstMBI	GATC	2 cut(s)	67, 448
BstMWI	GCNNNNNNNGC	3 cut(s)	401, 418, 707
BstNI	CCWGG	2 cut(s)	130, 698
BstSCI	CCNGG	2 cut(s)	128, 696
BstV1I	GCAGC	3 cut(s)	180, 379, 803
BstV2I	GAAGAC	2 cut(s)	727, 760
BstXI	CCANNNNNNTGG	1 cut(s)	32
Bsu15I	ATCGAT	1 cut(s)	447
BsuRI	GGCC	1 cut(s)	836
BsuTUI	ATCGAT	1 cut(s)	447
BtrI	CACGTC	1 cut(s)	1028
BtsCI	GGATG	3 cut(s)	301, 325, 830
BtsIMutI	CAGTG	2 cut(s)	61, 996
Cac8I	GCNNGC	3 cut(s)	476, 712, 1039
CciI	TCATGA	1 cut(s)	310
Cfr13I	GGNCC	2 cut(s)	614, 704
ClaI	ATCGAT	1 cut(s)	447
Csp6I	GTAC	1 cut(s)	133
CviAII	CATG	7 cut(s)	311, 436, 677, 819, 949, 989, 1022
CviQI	GTAC	1 cut(s)	133
DdeI	CTNAG	2 cut(s)	666, 999
DpnI	GATC	2 cut(s)	69, 450
DpnII	GATC	2 cut(s)	67, 448
Eam1104I	CTCTTC	1 cut(s)	551
EarI	CTCTTC	1 cut(s)	551
Eco32I	GATATC	2 cut(s)	445, 577
Eco47I	GGWCC	2 cut(s)	614, 704
EcoO109I	RGGNCCY	1 cut(s)	614
EcoRII	CCWGG	2 cut(s)	128, 696
EcoRV	GATATC	2 cut(s)	445, 577
FaeI	CATG	7 cut(s)	314, 439, 680, 822, 952, 992, 1025
FaqI	GGGAC	1 cut(s)	217
FatI	CATG	7 cut(s)	310, 435, 676, 818, 948, 988, 1021
FauNDI	CATATG	1 cut(s)	787
FblI	GTMKAC	1 cut(s)	993
Fnu4HI	GCNGC	5 cut(s)	194, 393, 472, 792, 1042
FokI	GGATG	3 cut(s)	308, 312, 837
Fsp4HI	GCNGC	5 cut(s)	194, 393, 472, 792, 1042
FspBI	CTAG	2 cut(s)	207, 1011
GluI	GCNGC	5 cut(s)	194, 393, 472, 792, 1042
HaeIII	GGCC	1 cut(s)	836
Hin1II	CATG	7 cut(s)	314, 439, 680, 822, 952, 992, 1025
HincII	GTYRAC	1 cut(s)	184
HindII	GTYRAC	1 cut(s)	184
HindIII	AAGCTT	1 cut(s)	668
HinfI	GANTC	1 cut(s)	490
HphI	GGTGA	6 cut(s)	17, 274, 335, 500, 730, 875
Hpy166II	GTNNAC	2 cut(s)	184, 994
Hpy188I	TCNGA	2 cut(s)	841, 918
Hpy188III	TCNNGA	5 cut(s)	218, 250, 311, 452, 494
Hpy8I	GTNNAC	2 cut(s)	184, 994
Hpy99I	CGWCG	2 cut(s)	152, 155
HpyAV	CCTTC	4 cut(s)	247, 377, 602, 652
HpyCH4III	ACNGT	5 cut(s)	79, 95, 188, 849, 961
HpyCH4IV	ACGT	2 cut(s)	105, 1027
HpyCH4V	TGCA	8 cut(s)	48, 196, 280, 287, 332, 395, 791, 812
HpyF10VI	GCNNNNNNNGC	3 cut(s)	401, 418, 707
HpyF3I	CTNAG	2 cut(s)	666, 999
HpySE526I	ACGT	2 cut(s)	105, 1027
Hsp92II	CATG	7 cut(s)	314, 439, 680, 822, 952, 992, 1025
Kzo9I	GATC	2 cut(s)	67, 448
LmnI	GCTCC	1 cut(s)	904
Lsp1109I	GCAGC	3 cut(s)	180, 379, 803
LweI	GCATC	3 cut(s)	267, 526, 997
MaeI	CTAG	2 cut(s)	207, 1011
MaeII	ACGT	2 cut(s)	105, 1027
MaeIII	GTNAC	3 cut(s)	341, 430, 691
MalI	GATC	2 cut(s)	69, 450
MboI	GATC	2 cut(s)	67, 448
MboII	GAAGA	8 cut(s)	149, 286, 568, 727, 760, 891, 899, 1016
MhlI	GDGCHC	1 cut(s)	928
MluCI	AATT	9 cut(s)	62, 299, 416, 548, 569, 654, 756, 882, 894
MseI	TTAA	6 cut(s)	90, 531, 660, 672, 759, 1047
MslI	CAYNNNNRTG	5 cut(s)	30, 337, 689, 823, 1026
MspA1I	CMGCKG	1 cut(s)	392
MspR9I	CCNGG	2 cut(s)	130, 698
MvaI	CCWGG	2 cut(s)	130, 698
MwoI	GCNNNNNNNGC	3 cut(s)	401, 418, 707
NdeI	CATATG	1 cut(s)	787
NdeII	GATC	2 cut(s)	67, 448
NlaIII	CATG	7 cut(s)	314, 439, 680, 822, 952, 992, 1025
NlaIV	GGNNCC	1 cut(s)	783
NmuCI	GTSAC	2 cut(s)	341, 691
PagI	TCATGA	1 cut(s)	310
PfeI	GAWTC	1 cut(s)	490
PkrI	GCNGC	5 cut(s)	195, 394, 473, 793, 1043
Ppu21I	YACGTR	1 cut(s)	106
PpuMI	RGGWCCY	1 cut(s)	614
PshBI	ATTAAT	1 cut(s)	531
Psp5II	RGGWCCY	1 cut(s)	614
Psp6I	CCWGG	2 cut(s)	128, 696
PspGI	CCWGG	2 cut(s)	128, 696
PspN4I	GGNNCC	1 cut(s)	783
PspPI	GGNCC	2 cut(s)	614, 704
PspPPI	RGGWCCY	1 cut(s)	614
PvuII	CAGCTG	1 cut(s)	392
RsaI	GTAC	1 cut(s)	134
RsaNI	GTAC	1 cut(s)	133
RseI	CAYNNNNRTG	5 cut(s)	30, 337, 689, 823, 1026
SaqAI	TTAA	6 cut(s)	90, 531, 660, 672, 759, 1047
SatI	GCNGC	5 cut(s)	194, 393, 472, 792, 1042
Sau3AI	GATC	2 cut(s)	67, 448
Sau96I	GGNCC	2 cut(s)	614, 704
ScrFI	CCNGG	2 cut(s)	130, 698
SduI	GDGCHC	1 cut(s)	928
SfaNI	GCATC	3 cut(s)	267, 526, 997
SinI	GGWCC	2 cut(s)	614, 704
SmiMI	CAYNNNNRTG	5 cut(s)	30, 337, 689, 823, 1026
SmlI	CTYRAG	1 cut(s)	407
SmoI	CTYRAG	1 cut(s)	407
Sse9I	AATT	9 cut(s)	62, 299, 416, 548, 569, 654, 756, 882, 894
SsiI	CCGC	3 cut(s)	11, 472, 1042
SspMI	CTAG	2 cut(s)	207, 1011
StyD4I	CCNGG	2 cut(s)	128, 696
TaaI	ACNGT	5 cut(s)	79, 95, 188, 849, 961
TaiI	ACGT	2 cut(s)	108, 1030
TaqI	TCGA	3 cut(s)	147, 447, 573
TasI	AATT	9 cut(s)	62, 299, 416, 548, 569, 654, 756, 882, 894
TauI	GCSGC	2 cut(s)	474, 1044
TfiI	GAWTC	1 cut(s)	490
Tru1I	TTAA	6 cut(s)	90, 531, 660, 672, 759, 1047
Tru9I	TTAA	6 cut(s)	90, 531, 660, 672, 759, 1047
TscAI	CASTG	2 cut(s)	61, 1003
TseFI	GTSAC	2 cut(s)	341, 691
TseI	GCWGC	3 cut(s)	193, 392, 791
Tsp45I	GTSAC	2 cut(s)	341, 691
TspDTI	ATGAA	8 cut(s)	312, 355, 503, 858, 922, 965, 996, 1010
TspRI	CASTG	2 cut(s)	61, 1003
VpaK11BI	GGWCC	2 cut(s)	614, 704
VspI	ATTAAT	1 cut(s)	531
XapI	RAATTY	4 cut(s)	62, 299, 569, 654
XcmI	CCANNNNNNNNNTGG	1 cut(s)	547
XmiI	GTMKAC	1 cut(s)	993
XspI	CTAG	2 cut(s)	207, 1011

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.