Rmu_sc0015881.1_g000007

Thermospermine synthase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0015881.1
Physical Location & Seq
Reverse (-)
23262 .. 25580
2319 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0015881.1_g000007.1.cds

Sequence Viewer

Length: 1047 bp
atgggagaggctgttgagtttttccatctaaacggtttcttgtcatcaaaatttgatcgtcatgacgaagtactcatcaacaataacgtcaacggtaacattaaccatgaagatatagatggttctggcagctggtacgaagagaccattgacgatgatctgaaatggtcatttgctcttaatggtgttctgcacaagggggtgagcgagtatcaggagatagcattactggataccaagcgttttggcaaggtattggtgattgatgggaagatgcagagtgcagaagtggacgagtttatatatcatgaatgcttaatacatcctgcccttttatctcacccaaagcctaagaatgtgttcattatgggaggtggggaagggtcagctgcaagagaagcccttaggcacaaattacttgacaaagtggttatgtgtgacatagatcaggaggtggttaatttctgtcgcaggcatttgacagtgaaccaaaaggcctttgctcacaataagcttaaccttgttatcaatgatgccaaggctgaattggataagagctgtgaaaaattcgacatcatagtgggagatttagcagacccagttgaaggagggccttgctatcagctttacacaaaatccttctatgagaaaattctcaaacccaagcttaatcatgggggcatttttgtgacccaggctggaccagcgggcattttcacccacaaagaggtgttcacctctatattcaacaccatcaaacaggtcttcaagtacgttgtggtttatgcagctcacataccttcttttgccgatacatggggatgggtcatggcctcggatgaacctttctctatgaatgctgagaaaatggacagaaggatcgaggaaagaattgacggggagttaaactacttgaatggtgctttgttcatgtcctctgcaaccatgaacaaaactgtttcttcatcgttgttgaaagaaactcatgtctacactgaagaagatgctaggtttattcatggacatggggtcgcttaccgcaactag

Protein Analysis

348

Amino Acids

39.28

Weight (kDa)

5.58

Isoelectric Point (pI)

34.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 990
AciI CCGC 2 cut(s) 707, 1039
AclWI GGATC 1 cut(s) 887
AcsI RAATTY 3 cut(s) 50, 566, 651
AcuI CTGAAG 1 cut(s) 1017
AfaI GTAC 3 cut(s) 72, 137, 773
AfiI CCNNNNNNNGG 3 cut(s) 605, 727, 816
AgsI TTSAA 5 cut(s) 605, 748, 769, 916, 976
AhdI GACNNNNNGTC 1 cut(s) 1028
AjnI CCWGG 1 cut(s) 693
AluBI AGCT 7 cut(s) 132, 389, 514, 558, 625, 667, 791
AluI AGCT 7 cut(s) 132, 389, 514, 558, 625, 667, 791
Alw26I GTCTC 1 cut(s) 137
AlwI GGATC 1 cut(s) 887
AoxI GGCC 3 cut(s) 495, 611, 831
ApeKI GCWGC 3 cut(s) 129, 389, 788
ApoI RAATTY 3 cut(s) 50, 566, 651
Asp700I GAANNNNTTC 1 cut(s) 359
AspS9I GGNCC 2 cut(s) 611, 701
AsuHPI GGTGA 5 cut(s) 214, 271, 332, 709, 727
AvaII GGWCC 1 cut(s) 701
AxyI CCTNAGG 1 cut(s) 404
BbsI GAAGAC 1 cut(s) 757
BbvI GCAGC 3 cut(s) 141, 376, 800
BccI CCATC 5 cut(s) 33, 113, 260, 761, 816
BciT130I CCWGG 1 cut(s) 695
BciVI GTATCC 1 cut(s) 226
BcoDI GTCTC 1 cut(s) 137
BfaI CTAG 2 cut(s) 1008, 1045
BfuI GTATCC 1 cut(s) 226
BisI GCNGC 3 cut(s) 130, 390, 789
BlsI GCNGC 3 cut(s) 131, 391, 790
BmcAI AGTACT 1 cut(s) 72
Bme1390I CCNGG 1 cut(s) 695
Bme18I GGWCC 1 cut(s) 701
BmeRI GACNNNNNGTC 1 cut(s) 1028
BmgT120I GGNCC 2 cut(s) 611, 701
BmrFI CCNGG 1 cut(s) 695
BmrI ACTGGG 1 cut(s) 593
BmsI GCATC 3 cut(s) 264, 523, 994
BmuI ACTGGG 1 cut(s) 593
BpiI GAAGAC 1 cut(s) 757
BsaI GGTCTC 1 cut(s) 137
BsaJI CCNNGG 3 cut(s) 537, 693, 834
BsaXI ACNNNNNCTCC 1 cut(s) 27
Bsc4I CCNNNNNNNGG 3 cut(s) 605, 727, 816
Bse1I ACTGG 2 cut(s) 234, 599
Bse21I CCTNAGG 1 cut(s) 404
BseBI CCWGG 1 cut(s) 695
BseDI CCNNGG 3 cut(s) 537, 693, 834
BseGI GGATG 3 cut(s) 322, 827, 844
BseLI CCNNNNNNNGG 3 cut(s) 605, 727, 816
BseMII CTCAG 1 cut(s) 852
BseNI ACTGG 2 cut(s) 234, 599
BseXI GCAGC 3 cut(s) 141, 376, 800
BsgI GTGCAG 2 cut(s) 176, 303
BshFI GGCC 3 cut(s) 497, 613, 833
BslI CCNNNNNNNGG 3 cut(s) 605, 727, 816
BsmAI GTCTC 1 cut(s) 137
BsmI GAATGC 2 cut(s) 317, 862
BsnI GGCC 3 cut(s) 497, 613, 833
Bso31I GGTCTC 1 cut(s) 137
Bsp143I GATC 4 cut(s) 55, 157, 445, 879
BspACI CCGC 2 cut(s) 707, 1039
BspANI GGCC 3 cut(s) 497, 613, 833
BspCNI CTCAG 1 cut(s) 853
BspHI TCATGA 2 cut(s) 61, 307
BspPI GGATC 1 cut(s) 887
BspTNI GGTCTC 1 cut(s) 137
BsrI ACTGG 2 cut(s) 234, 599
BssECI CCNNGG 3 cut(s) 537, 693, 834
BssMI GATC 4 cut(s) 55, 157, 445, 879
BssT1I CCWWGG 1 cut(s) 537
Bst2UI CCWGG 1 cut(s) 695
Bst4CI ACNGT 4 cut(s) 35, 95, 484, 958
Bst6I CTCTTC 1 cut(s) 135
BstC8I GCNNGC 2 cut(s) 473, 709
BstDEI CTNAG 3 cut(s) 351, 404, 861
BstF5I GGATG 3 cut(s) 322, 827, 844
BstKTI GATC 4 cut(s) 58, 160, 448, 882
BstMAI GTCTC 1 cut(s) 137
BstMBI GATC 4 cut(s) 55, 157, 445, 879
BstMWI GCNNNNNNNGC 2 cut(s) 398, 704
BstNI CCWGG 1 cut(s) 695
BstSCI CCNGG 1 cut(s) 693
BstV1I GCAGC 3 cut(s) 141, 376, 800
BstV2I GAAGAC 1 cut(s) 757
Bsu36I CCTNAGG 1 cut(s) 404
BsuI GTATCC 1 cut(s) 226
BsuRI GGCC 3 cut(s) 497, 613, 833
BtsCI GGATG 3 cut(s) 322, 827, 844
BtsIMutI CAGTG 2 cut(s) 489, 993
Cac8I GCNNGC 2 cut(s) 473, 709
CciI TCATGA 2 cut(s) 61, 307
Cfr13I GGNCC 2 cut(s) 611, 701
Csp6I GTAC 3 cut(s) 71, 136, 772
CviQI GTAC 3 cut(s) 71, 136, 772
DdeI CTNAG 3 cut(s) 351, 404, 861
DpnI GATC 4 cut(s) 57, 159, 447, 881
DpnII GATC 4 cut(s) 55, 157, 445, 879
DriI GACNNNNNGTC 1 cut(s) 1028
Eam1104I CTCTTC 1 cut(s) 135
Eam1105I GACNNNNNGTC 1 cut(s) 1028
EarI CTCTTC 1 cut(s) 135
Eco130I CCWWGG 1 cut(s) 537
Eco147I AGGCCT 1 cut(s) 497
Eco31I GGTCTC 1 cut(s) 137
Eco47I GGWCC 1 cut(s) 701
Eco57I CTGAAG 1 cut(s) 1017
Eco81I CCTNAGG 1 cut(s) 404
EcoO109I RGGNCCY 1 cut(s) 611
EcoRII CCWGG 1 cut(s) 693
EcoT14I CCWWGG 1 cut(s) 537
ErhI CCWWGG 1 cut(s) 537
FauI CCCGC 1 cut(s) 700
FblI GTMKAC 1 cut(s) 990
Fnu4HI GCNGC 3 cut(s) 130, 390, 789
FokI GGATG 3 cut(s) 309, 834, 851
Fsp4HI GCNGC 3 cut(s) 130, 390, 789
FspBI CTAG 2 cut(s) 1008, 1045
GluI GCNGC 3 cut(s) 130, 390, 789
HaeIII GGCC 3 cut(s) 497, 613, 833
HincII GTYRAC 1 cut(s) 91
HindII GTYRAC 1 cut(s) 91
HindIII AAGCTT 2 cut(s) 512, 665
HphI GGTGA 5 cut(s) 214, 271, 332, 709, 727
Hpy166II GTNNAC 5 cut(s) 91, 292, 487, 735, 991
Hpy188I TCNGA 2 cut(s) 162, 838
Hpy188III TCNNGA 4 cut(s) 62, 215, 308, 449
Hpy8I GTNNAC 5 cut(s) 91, 292, 487, 735, 991
HpyAV CCTTC 5 cut(s) 374, 599, 649, 810, 870
HpyCH4III ACNGT 4 cut(s) 35, 95, 484, 958
HpyCH4IV ACGT 2 cut(s) 87, 774
HpyCH4V TGCA 6 cut(s) 193, 277, 284, 392, 788, 941
HpyF10VI GCNNNNNNNGC 2 cut(s) 398, 704
HpyF3I CTNAG 3 cut(s) 351, 404, 861
HpySE526I ACGT 2 cut(s) 87, 774
Kzo9I GATC 4 cut(s) 55, 157, 445, 879
Lsp1109I GCAGC 3 cut(s) 141, 376, 800
LweI GCATC 3 cut(s) 264, 523, 994
MaeI CTAG 2 cut(s) 1008, 1045
MaeII ACGT 2 cut(s) 87, 774
MaeIII GTNAC 3 cut(s) 95, 437, 688
MalI GATC 4 cut(s) 57, 159, 447, 881
MboI GATC 4 cut(s) 55, 157, 445, 879
MboII GAAGA 7 cut(s) 122, 152, 283, 757, 954, 1010, 1013
MluCI AATT 7 cut(s) 50, 413, 460, 545, 566, 651, 891
MnlI CCTC 8 cut(s) 365, 445, 602, 721, 748, 844, 877, 946
MroXI GAANNNNTTC 1 cut(s) 359
MseI TTAA 7 cut(s) 102, 180, 317, 459, 516, 669, 905
MslI CAYNNNNRTG 4 cut(s) 578, 686, 820, 1023
MspA1I CMGCKG 3 cut(s) 132, 389, 707
MspR9I CCNGG 1 cut(s) 695
Mva1269I GAATGC 2 cut(s) 317, 862
MvaI CCWGG 1 cut(s) 695
MwoI GCNNNNNNNGC 2 cut(s) 398, 704
NdeII GATC 4 cut(s) 55, 157, 445, 879
NmuCI GTSAC 2 cut(s) 437, 688
PagI TCATGA 2 cut(s) 61, 307
PceI AGGCCT 1 cut(s) 497
PctI GAATGC 2 cut(s) 317, 862
PdmI GAANNNNTTC 1 cut(s) 359
PkrI GCNGC 3 cut(s) 131, 391, 790
Psp6I CCWGG 1 cut(s) 693
PspGI CCWGG 1 cut(s) 693
PspPI GGNCC 2 cut(s) 611, 701
PvuII CAGCTG 2 cut(s) 132, 389
RsaI GTAC 3 cut(s) 72, 137, 773
RsaNI GTAC 3 cut(s) 71, 136, 772
RseI CAYNNNNRTG 4 cut(s) 578, 686, 820, 1023
SaqAI TTAA 7 cut(s) 102, 180, 317, 459, 516, 669, 905
SatI GCNGC 3 cut(s) 130, 390, 789
Sau3AI GATC 4 cut(s) 55, 157, 445, 879
Sau96I GGNCC 2 cut(s) 611, 701
ScaI AGTACT 1 cut(s) 72
ScrFI CCNGG 1 cut(s) 695
SfaNI GCATC 3 cut(s) 264, 523, 994
SinI GGWCC 1 cut(s) 701
SmiMI CAYNNNNRTG 4 cut(s) 578, 686, 820, 1023
Sse9I AATT 7 cut(s) 50, 413, 460, 545, 566, 651, 891
SseBI AGGCCT 1 cut(s) 497
SsiI CCGC 2 cut(s) 707, 1039
SspMI CTAG 2 cut(s) 1008, 1045
StuI AGGCCT 1 cut(s) 497
StyD4I CCNGG 1 cut(s) 693
StyI CCWWGG 1 cut(s) 537
TaaI ACNGT 4 cut(s) 35, 95, 484, 958
TaiI ACGT 2 cut(s) 90, 777
TaqI TCGA 2 cut(s) 570, 882
TasI AATT 7 cut(s) 50, 413, 460, 545, 566, 651, 891
TatI WGTACW 1 cut(s) 70
Tru1I TTAA 7 cut(s) 102, 180, 317, 459, 516, 669, 905
Tru9I TTAA 7 cut(s) 102, 180, 317, 459, 516, 669, 905
TscAI CASTG 2 cut(s) 489, 1000
TseFI GTSAC 2 cut(s) 437, 688
TseI GCWGC 3 cut(s) 129, 389, 788
Tsp45I GTSAC 2 cut(s) 437, 688
TspDTI ATGAA 9 cut(s) 123, 324, 352, 855, 869, 919, 954, 962, 1007
TspRI CASTG 2 cut(s) 489, 1000
VpaK11BI GGWCC 1 cut(s) 701
XapI RAATTY 3 cut(s) 50, 566, 651
XcmI CCANNNNNNNNNTGG 1 cut(s) 544
XmiI GTMKAC 1 cut(s) 990
XmnI GAANNNNTTC 1 cut(s) 359
XspI CTAG 2 cut(s) 1008, 1045
ZrmI AGTACT 1 cut(s) 72
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.