MD16G1176900.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr16
Physical Location & Seq
Forward (+)
15051849 .. 15054190
2342 bp
Loading structure...
UTR
Exon/CDS
Intron
MD16G1176900.v1.1.491

Sequence Viewer

Length: 156 bp
ATGGAATTTTTCATGATCAAGACCGGCTTCTATGACAAAGTAACTGTTCTTGAATCAGAGAAACGGGCTTATGAAAATTCGCCAGAGGCCCAAGCTATCAGGGAAGCTCTCAATCCGTGGAGAAATCGTGATGCAGAAGCAAGCAAGGAATCCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

52

Amino Acids

5.98

Weight (kDa)

5.0

Isoelectric Point (pI)

42.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 5, 76
AgsI TTSAA 1 cut(s) 53
AluBI AGCT 2 cut(s) 95, 107
AluI AGCT 2 cut(s) 95, 107
AoxI GGCC 1 cut(s) 87
ApoI RAATTY 2 cut(s) 5, 76
AspS9I GGNCC 1 cut(s) 88
BclI TGATCA 1 cut(s) 15
BmgT120I GGNCC 1 cut(s) 88
BmsI GCATC 1 cut(s) 121
BsaJI CCNNGG 1 cut(s) 116
BsaXI ACNNNNNCTCC 2 cut(s) 112, 142
Bse118I RCCGGY 1 cut(s) 23
BseDI CCNNGG 1 cut(s) 116
BshFI GGCC 1 cut(s) 89
BsiSI CCGG 1 cut(s) 24
BsnI GGCC 1 cut(s) 89
Bsp143I GATC 1 cut(s) 15
BspANI GGCC 1 cut(s) 89
BspHI TCATGA 1 cut(s) 12
BsrFI RCCGGY 1 cut(s) 23
BssAI RCCGGY 1 cut(s) 23
BssECI CCNNGG 1 cut(s) 116
BssMI GATC 1 cut(s) 15
Bst4CI ACNGT 1 cut(s) 46
BstC8I GCNNGC 1 cut(s) 142
BstDSI CCRYGG 1 cut(s) 116
BstKTI GATC 1 cut(s) 18
BstMBI GATC 1 cut(s) 15
BsuRI GGCC 1 cut(s) 89
BtgI CCRYGG 1 cut(s) 116
Cac8I GCNNGC 1 cut(s) 142
CciI TCATGA 1 cut(s) 12
Cfr10I RCCGGY 1 cut(s) 23
Cfr13I GGNCC 1 cut(s) 88
CviAII CATG 1 cut(s) 13
CviJI RGCY 5 cut(s) 27, 68, 89, 95, 107
CviKI_1 RGCY 5 cut(s) 27, 68, 89, 95, 107
DpnI GATC 1 cut(s) 17
DpnII GATC 1 cut(s) 15
FaeI CATG 1 cut(s) 16
FaiI YATR 3 cut(s) 14, 33, 72
FalI AAGNNNNNCTT 2 cut(s) 11, 43
FatI CATG 1 cut(s) 12
FbaI TGATCA 1 cut(s) 15
HaeIII GGCC 1 cut(s) 89
HapII CCGG 1 cut(s) 24
Hin1II CATG 1 cut(s) 16
HinfI GANTC 2 cut(s) 53, 149
HpaII CCGG 1 cut(s) 24
Hpy188I TCNGA 1 cut(s) 58
Hpy188III TCNNGA 4 cut(s) 13, 19, 50, 128
HpyCH4III ACNGT 1 cut(s) 46
HpyCH4V TGCA 1 cut(s) 134
Hsp92II CATG 1 cut(s) 16
Ksp22I TGATCA 1 cut(s) 15
Kzo9I GATC 1 cut(s) 15
LpnPI CCDG 3 cut(s) 37, 85, 96
LweI GCATC 1 cut(s) 121
MaeIII GTNAC 1 cut(s) 40
MalI GATC 1 cut(s) 17
MboI GATC 1 cut(s) 15
MluCI AATT 2 cut(s) 5, 76
MnlI CCTC 1 cut(s) 79
MspI CCGG 1 cut(s) 24
NdeII GATC 1 cut(s) 15
NlaIII CATG 1 cut(s) 16
PagI TCATGA 1 cut(s) 12
PfeI GAWTC 2 cut(s) 53, 149
PspPI GGNCC 1 cut(s) 88
Sau3AI GATC 1 cut(s) 15
Sau96I GGNCC 1 cut(s) 88
SetI ASST 2 cut(s) 97, 109
SfaNI GCATC 1 cut(s) 121
Sse9I AATT 2 cut(s) 5, 76
TaaI ACNGT 1 cut(s) 46
TasI AATT 2 cut(s) 5, 76
TfiI GAWTC 2 cut(s) 53, 149
TspDTI ATGAA 1 cut(s) 87
TspGWI ACGGA 1 cut(s) 105
XapI RAATTY 2 cut(s) 5, 76
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.