RchiOBHm_Chr1g0363231

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
54690288 .. 54691221
934 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ58800

Sequence Viewer

Length: 153 bp
ATGAAGTTTCTAGATTGGTATTTGAAGATTGCATTTGGGTCAGCTCTGATTGGAGCTTCCATGGAGTTTTTCATGATCAAAACCGGCTTCTATGATAAAGTAACAATTTTGGAATCTGGAAAGATGGCTTGGGAGAATTCGCTAGAGGCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

50

Amino Acids

5.73

Weight (kDa)

5.05

Isoelectric Point (pI)

22.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 136
AgsI TTSAA 1 cut(s) 25
AjuI GAANNNNNNNTTGG 2 cut(s) 112, 144
AluBI AGCT 2 cut(s) 44, 56
AluI AGCT 2 cut(s) 44, 56
ApoI RAATTY 1 cut(s) 136
BccI CCATC 1 cut(s) 118
BclI TGATCA 1 cut(s) 75
BfaI CTAG 2 cut(s) 11, 143
BsaJI CCNNGG 1 cut(s) 60
Bse118I RCCGGY 1 cut(s) 83
BseDI CCNNGG 1 cut(s) 60
BsiSI CCGG 1 cut(s) 84
Bsp143I GATC 1 cut(s) 75
Bsp19I CCATGG 1 cut(s) 60
BspHI TCATGA 1 cut(s) 72
BsrFI RCCGGY 1 cut(s) 83
BssAI RCCGGY 1 cut(s) 83
BssECI CCNNGG 1 cut(s) 60
BssMI GATC 1 cut(s) 75
BssT1I CCWWGG 1 cut(s) 60
BstDEI CTNAG 1 cut(s) 150
BstDSI CCRYGG 1 cut(s) 60
BstKTI GATC 1 cut(s) 78
BstMBI GATC 1 cut(s) 75
BtgI CCRYGG 1 cut(s) 60
CciI TCATGA 1 cut(s) 72
Cfr10I RCCGGY 1 cut(s) 83
CviAII CATG 2 cut(s) 61, 73
CviJI RGCY 5 cut(s) 44, 56, 87, 128, 149
CviKI_1 RGCY 5 cut(s) 44, 56, 87, 128, 149
DdeI CTNAG 1 cut(s) 150
DpnI GATC 1 cut(s) 77
DpnII GATC 1 cut(s) 75
Eco130I CCWWGG 1 cut(s) 60
EcoRI GAATTC 1 cut(s) 136
EcoT14I CCWWGG 1 cut(s) 60
ErhI CCWWGG 1 cut(s) 60
FaeI CATG 2 cut(s) 64, 76
FaiI YATR 3 cut(s) 62, 74, 93
FatI CATG 2 cut(s) 60, 72
FbaI TGATCA 1 cut(s) 75
FspBI CTAG 2 cut(s) 11, 143
HapII CCGG 1 cut(s) 84
Hin1II CATG 2 cut(s) 64, 76
HinfI GANTC 1 cut(s) 113
HpaII CCGG 1 cut(s) 84
Hpy188I TCNGA 1 cut(s) 48
Hpy188III TCNNGA 3 cut(s) 11, 73, 117
HpyCH4V TGCA 1 cut(s) 32
HpyF3I CTNAG 1 cut(s) 150
Hsp92II CATG 2 cut(s) 64, 76
Ksp22I TGATCA 1 cut(s) 75
Kzo9I GATC 1 cut(s) 75
LmnI GCTCC 1 cut(s) 53
LpnPI CCDG 2 cut(s) 97, 102
MaeI CTAG 2 cut(s) 11, 143
MaeIII GTNAC 1 cut(s) 100
MalI GATC 1 cut(s) 77
MboI GATC 1 cut(s) 75
MboII GAAGA 1 cut(s) 37
MluCI AATT 2 cut(s) 105, 136
MnlI CCTC 1 cut(s) 139
MspI CCGG 1 cut(s) 84
NcoI CCATGG 1 cut(s) 60
NdeII GATC 1 cut(s) 75
NlaIII CATG 2 cut(s) 64, 76
PagI TCATGA 1 cut(s) 72
PfeI GAWTC 1 cut(s) 113
Sau3AI GATC 1 cut(s) 75
SetI ASST 2 cut(s) 46, 58
SgeI CNNG 6 cut(s) 23, 73, 85, 96, 129, 141
Sse9I AATT 2 cut(s) 105, 136
SspMI CTAG 2 cut(s) 11, 143
StyI CCWWGG 1 cut(s) 60
TasI AATT 2 cut(s) 105, 136
TfiI GAWTC 1 cut(s) 113
TspDTI ATGAA 2 cut(s) 17, 61
XapI RAATTY 1 cut(s) 136
XbaI TCTAGA 1 cut(s) 10
XspI CTAG 2 cut(s) 11, 143
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.