Rroxscaffold_5G00363200

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Reverse (-)
44288908 .. 44291176
2269 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00363200.1

Sequence Viewer

Length: 234 bp
ATGGGTGTAGTGCCAAAAGATGATATGAACGGTGGTTTTGGTGTTTCTCTAACTAGCAGAAAAGTGCAGAAGGATACAGTCAGCGATAACCGTAGAGATTCATCGGCGGATGATAAAGTAACAGTTCTGGAGTCTGAAAAACGTGCTTGGGAGAATTCGCCAGAGGCTCAGGCAGTCAGAGAAGCTCTCAATCCTTGGAGAAATCGTGATGTGGAAGCAAAGAAAGAATCCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

77

Amino Acids

8.62

Weight (kDa)

5.42

Isoelectric Point (pI)

40.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 107
AcsI RAATTY 1 cut(s) 154
AluBI AGCT 1 cut(s) 185
AluI AGCT 1 cut(s) 185
ApoI RAATTY 1 cut(s) 154
BciVI GTATCC 1 cut(s) 67
BfaI CTAG 1 cut(s) 54
BfuI GTATCC 1 cut(s) 67
BplI GAGNNNNNCTC 2 cut(s) 171, 203
BpmI CTGGAG 1 cut(s) 149
Bpu10I CCTNAGC 1 cut(s) 168
BsaJI CCNNGG 1 cut(s) 194
BsaXI ACNNNNNCTCC 2 cut(s) 190, 220
BseDI CCNNGG 1 cut(s) 194
BseGI GGATG 1 cut(s) 115
BseMII CTCAG 1 cut(s) 182
BsgI GTGCAG 1 cut(s) 86
BspACI CCGC 1 cut(s) 107
BspCNI CTCAG 1 cut(s) 181
BssECI CCNNGG 1 cut(s) 194
BssT1I CCWWGG 1 cut(s) 194
Bst4CI ACNGT 4 cut(s) 32, 79, 92, 124
BstDEI CTNAG 1 cut(s) 168
BstF5I GGATG 1 cut(s) 115
BsuI GTATCC 1 cut(s) 67
BtsCI GGATG 1 cut(s) 115
CviJI RGCY 2 cut(s) 167, 185
CviKI_1 RGCY 2 cut(s) 167, 185
DdeI CTNAG 1 cut(s) 168
EciI GGCGGA 1 cut(s) 122
Eco130I CCWWGG 1 cut(s) 194
EcoRI GAATTC 1 cut(s) 154
EcoT14I CCWWGG 1 cut(s) 194
ErhI CCWWGG 1 cut(s) 194
FaiI YATR 1 cut(s) 26
FokI GGATG 1 cut(s) 122
FspBI CTAG 1 cut(s) 54
GsuI CTGGAG 1 cut(s) 149
HinfI GANTC 3 cut(s) 98, 131, 227
Hpy188I TCNGA 2 cut(s) 136, 179
Hpy188III TCNNGA 2 cut(s) 128, 206
HpyAV CCTTC 1 cut(s) 64
HpyCH4III ACNGT 4 cut(s) 32, 79, 92, 124
HpyCH4IV ACGT 1 cut(s) 142
HpyCH4V TGCA 1 cut(s) 67
HpyF3I CTNAG 1 cut(s) 168
HpySE526I ACGT 1 cut(s) 142
LpnPI CCDG 3 cut(s) 113, 155, 174
MaeI CTAG 1 cut(s) 54
MaeII ACGT 1 cut(s) 142
MaeIII GTNAC 1 cut(s) 118
MluCI AATT 1 cut(s) 154
MlyI GAGTC 1 cut(s) 140
MnlI CCTC 1 cut(s) 157
PfeI GAWTC 2 cut(s) 98, 227
PleI GAGTC 1 cut(s) 139
PpsI GAGTC 1 cut(s) 139
SchI GAGTC 1 cut(s) 140
SetI ASST 2 cut(s) 145, 187
SgeI CNNG 8 cut(s) 66, 140, 155, 159, 173, 182, 207, 218
Sse9I AATT 1 cut(s) 154
SsiI CCGC 1 cut(s) 107
SspMI CTAG 1 cut(s) 54
StyI CCWWGG 1 cut(s) 194
TaaI ACNGT 4 cut(s) 32, 79, 92, 124
TaiI ACGT 1 cut(s) 145
TasI AATT 1 cut(s) 154
TfiI GAWTC 2 cut(s) 98, 227
TspDTI ATGAA 2 cut(s) 41, 90
XapI RAATTY 1 cut(s) 154
XspI CTAG 1 cut(s) 54
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.