Rroxscaffold_4G00293290

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Reverse (-)
13573883 .. 13577345
3463 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00293290.1

Sequence Viewer

Length: 216 bp
ATGAAGTTTCTAGATTGGTATTTGAAGATTGCATTTGGGTCGGCTCTGATTGGAGCTTCCATGGAGTTTTTCATGATCAAAACCGGCTTCTATGATAAAGTAACAGTTCTGGAATCTGAAAAGAGGGCTTGGGAGAATTCGCCAGAGGCTCAGGCAGTCAGAGAAGCTCTCAATCCTTGGAGAAATTGTGATGTAGAAGCAAAGAAGGAATCCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

71

Amino Acids

8.22

Weight (kDa)

5.36

Isoelectric Point (pI)

32.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 136
AgsI TTSAA 1 cut(s) 25
AluBI AGCT 2 cut(s) 56, 167
AluI AGCT 2 cut(s) 56, 167
ApoI RAATTY 1 cut(s) 136
BcgI CGANNNNNNTGC 2 cut(s) 21, 55
BclI TGATCA 1 cut(s) 75
BfaI CTAG 1 cut(s) 11
BplI GAGNNNNNCTC 2 cut(s) 153, 185
Bpu10I CCTNAGC 1 cut(s) 150
BsaJI CCNNGG 2 cut(s) 60, 176
BsaXI ACNNNNNCTCC 2 cut(s) 172, 202
Bse118I RCCGGY 1 cut(s) 83
BseDI CCNNGG 2 cut(s) 60, 176
BseMII CTCAG 1 cut(s) 164
BsiSI CCGG 1 cut(s) 84
Bsp143I GATC 1 cut(s) 75
Bsp19I CCATGG 1 cut(s) 60
BspCNI CTCAG 1 cut(s) 163
BspHI TCATGA 1 cut(s) 72
BsrFI RCCGGY 1 cut(s) 83
BssAI RCCGGY 1 cut(s) 83
BssECI CCNNGG 2 cut(s) 60, 176
BssMI GATC 1 cut(s) 75
BssT1I CCWWGG 2 cut(s) 60, 176
Bst4CI ACNGT 1 cut(s) 106
BstDEI CTNAG 1 cut(s) 150
BstDSI CCRYGG 1 cut(s) 60
BstKTI GATC 1 cut(s) 78
BstMBI GATC 1 cut(s) 75
BtgI CCRYGG 1 cut(s) 60
CciI TCATGA 1 cut(s) 72
Cfr10I RCCGGY 1 cut(s) 83
CviAII CATG 2 cut(s) 61, 73
CviJI RGCY 6 cut(s) 44, 56, 87, 128, 149, 167
CviKI_1 RGCY 6 cut(s) 44, 56, 87, 128, 149, 167
DdeI CTNAG 1 cut(s) 150
DpnI GATC 1 cut(s) 77
DpnII GATC 1 cut(s) 75
Eco130I CCWWGG 2 cut(s) 60, 176
EcoRI GAATTC 1 cut(s) 136
EcoT14I CCWWGG 2 cut(s) 60, 176
ErhI CCWWGG 2 cut(s) 60, 176
FaeI CATG 2 cut(s) 64, 76
FaiI YATR 3 cut(s) 62, 74, 93
FatI CATG 2 cut(s) 60, 72
FbaI TGATCA 1 cut(s) 75
FspBI CTAG 1 cut(s) 11
HapII CCGG 1 cut(s) 84
Hin1II CATG 2 cut(s) 64, 76
HinfI GANTC 2 cut(s) 113, 209
HpaII CCGG 1 cut(s) 84
Hpy188I TCNGA 3 cut(s) 48, 118, 161
Hpy188III TCNNGA 3 cut(s) 11, 73, 110
HpyAV CCTTC 1 cut(s) 199
HpyCH4III ACNGT 1 cut(s) 106
HpyCH4V TGCA 1 cut(s) 32
HpyF3I CTNAG 1 cut(s) 150
Hsp92II CATG 2 cut(s) 64, 76
Ksp22I TGATCA 1 cut(s) 75
Kzo9I GATC 1 cut(s) 75
LmnI GCTCC 1 cut(s) 53
LpnPI CCDG 4 cut(s) 95, 97, 137, 156
MaeI CTAG 1 cut(s) 11
MaeIII GTNAC 1 cut(s) 100
MalI GATC 1 cut(s) 77
MboI GATC 1 cut(s) 75
MboII GAAGA 1 cut(s) 37
MluCI AATT 2 cut(s) 136, 184
MnlI CCTC 2 cut(s) 117, 139
MspI CCGG 1 cut(s) 84
NcoI CCATGG 1 cut(s) 60
NdeII GATC 1 cut(s) 75
NlaIII CATG 2 cut(s) 64, 76
PagI TCATGA 1 cut(s) 72
PfeI GAWTC 2 cut(s) 113, 209
Sau3AI GATC 1 cut(s) 75
SetI ASST 2 cut(s) 58, 169
SgeI CNNG 9 cut(s) 23, 73, 85, 96, 122, 141, 155, 164, 189
Sse9I AATT 2 cut(s) 136, 184
SspMI CTAG 1 cut(s) 11
StyI CCWWGG 2 cut(s) 60, 176
TaaI ACNGT 1 cut(s) 106
TasI AATT 2 cut(s) 136, 184
TfiI GAWTC 2 cut(s) 113, 209
TspDTI ATGAA 2 cut(s) 17, 61
XapI RAATTY 1 cut(s) 136
XbaI TCTAGA 1 cut(s) 10
XspI CTAG 1 cut(s) 11
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.