Rroxscaffold_6G00393620

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
Physical Location & Seq
Forward (+)
13760453 .. 13763362
2910 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00393620.1

Sequence Viewer

Length: 222 bp
ATGTGGTCCAAGATTTTTAGAGAAACAACTCTTGAACAGAATTTTCTCAAGGGAATGAAAGATCCAAAGCTTGATGGAAATCTAAAGACACAAAGAGAAGATGGGTCATTGATCAGGTCAAGCGAAGTAAAAATGATTCATGAAGAAGCATGGGTTGGCGGAAGCTCTGAAAAAGGTCGTTATAGAAACCATTCCATTCTTCCCTCAAAGAAAAGTGACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

73

Amino Acids

8.44

Weight (kDa)

9.4

Isoelectric Point (pI)

36.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 159
AclWI GGATC 1 cut(s) 56
AcsI RAATTY 1 cut(s) 40
AgsI TTSAA 1 cut(s) 35
AjuI GAANNNNNNNTTGG 2 cut(s) 138, 170
AluBI AGCT 2 cut(s) 70, 165
AluI AGCT 2 cut(s) 70, 165
AlwI GGATC 1 cut(s) 56
ApoI RAATTY 1 cut(s) 40
Asp700I GAANNNNTTC 1 cut(s) 190
AspS9I GGNCC 1 cut(s) 6
AvaII GGWCC 1 cut(s) 6
BccI CCATC 2 cut(s) 68, 95
BclI TGATCA 1 cut(s) 111
Bme18I GGWCC 1 cut(s) 6
BmgT120I GGNCC 1 cut(s) 6
BpuEI CTTGAG 1 cut(s) 32
BsaBI GATNNNNATC 1 cut(s) 78
Bse8I GATNNNNATC 1 cut(s) 78
BseJI GATNNNNATC 1 cut(s) 78
Bsp143I GATC 2 cut(s) 61, 111
BspACI CCGC 1 cut(s) 159
BspHI TCATGA 1 cut(s) 139
BspPI GGATC 1 cut(s) 56
BssMI GATC 2 cut(s) 61, 111
BstKTI GATC 2 cut(s) 64, 114
BstMBI GATC 2 cut(s) 61, 111
BstX2I RGATCY 1 cut(s) 61
BstYI RGATCY 1 cut(s) 61
CciI TCATGA 1 cut(s) 139
Cfr13I GGNCC 1 cut(s) 6
CviAII CATG 2 cut(s) 140, 150
CviJI RGCY 2 cut(s) 70, 165
CviKI_1 RGCY 2 cut(s) 70, 165
DpnI GATC 2 cut(s) 63, 113
DpnII GATC 2 cut(s) 61, 111
EciI GGCGGA 1 cut(s) 174
Eco47I GGWCC 1 cut(s) 6
FaeI CATG 2 cut(s) 143, 153
FaiI YATR 3 cut(s) 141, 151, 183
FatI CATG 2 cut(s) 139, 149
FbaI TGATCA 1 cut(s) 111
Hin1II CATG 2 cut(s) 143, 153
HindIII AAGCTT 1 cut(s) 68
HinfI GANTC 1 cut(s) 136
Hpy188I TCNGA 1 cut(s) 169
Hpy188III TCNNGA 2 cut(s) 32, 140
Hsp92II CATG 2 cut(s) 143, 153
Ksp22I TGATCA 1 cut(s) 111
Kzo9I GATC 2 cut(s) 61, 111
LpnPI CCDG 1 cut(s) 100
MaeIII GTNAC 1 cut(s) 215
MalI GATC 2 cut(s) 63, 113
MboI GATC 2 cut(s) 61, 111
MboII GAAGA 3 cut(s) 110, 155, 191
MflI RGATCY 1 cut(s) 61
MluCI AATT 1 cut(s) 40
MnlI CCTC 1 cut(s) 214
MroXI GAANNNNTTC 1 cut(s) 190
NdeII GATC 2 cut(s) 61, 111
NlaIII CATG 2 cut(s) 143, 153
NmuCI GTSAC 1 cut(s) 215
PagI TCATGA 1 cut(s) 139
PdmI GAANNNNTTC 1 cut(s) 190
PfeI GAWTC 1 cut(s) 136
PspPI GGNCC 1 cut(s) 6
PsuI RGATCY 1 cut(s) 61
Sau3AI GATC 2 cut(s) 61, 111
Sau96I GGNCC 1 cut(s) 6
SetI ASST 4 cut(s) 72, 119, 167, 178
SgeI CNNG 8 cut(s) 22, 44, 61, 83, 127, 132, 152, 162
SinI GGWCC 1 cut(s) 6
SmlI CTYRAG 1 cut(s) 47
SmoI CTYRAG 1 cut(s) 47
Sse9I AATT 1 cut(s) 40
SsiI CCGC 1 cut(s) 159
TasI AATT 1 cut(s) 40
TfiI GAWTC 1 cut(s) 136
TseFI GTSAC 1 cut(s) 215
Tsp45I GTSAC 1 cut(s) 215
TspDTI ATGAA 3 cut(s) 71, 128, 156
VpaK11BI GGWCC 1 cut(s) 6
XapI RAATTY 1 cut(s) 40
XmnI GAANNNNTTC 1 cut(s) 190
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.