MD17G1093700.v1.1

Belongs to the peroxidase family. Classical plant (class III) peroxidase subfamily

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr17
Physical Location & Seq
Reverse (-)
7860552 .. 7860962
411 bp
Loading structure...
UTR
Exon/CDS
Intron
MD17G1093700.v1.1.491

Sequence Viewer

Length: 234 bp
ATGCATTTTCATGATTGTTTTGTTAGTGGATGTGATGGTTCTGTGCTATTGAATTCCACATCAAACAGTCATGCTGAGAAAGAAACAATCCCCAACCAGAGCTTAAGAGGGTTCCATGTCATAGATGCAGTAAAATCTGCAGTAGAAGAGAAGTGTCCTGGTGTTGTTTCTTGTGCTGATATCTTGGCCTTGGTAGCTCGTGATACAGTTAGAATTATTAACCATAGTCATTAG

Protein Analysis

78

Amino Acids

8.32

Weight (kDa)

6.0

Isoelectric Point (pI)

34.26

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
peroxidase PF00141 1 - 72 3.9e-28 Peroxidase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 52
AflII CTTAAG 1 cut(s) 103
AgsI TTSAA 1 cut(s) 52
AjnI CCWGG 1 cut(s) 157
AluBI AGCT 2 cut(s) 102, 197
AluI AGCT 2 cut(s) 102, 197
AoxI GGCC 1 cut(s) 186
ApoI RAATTY 1 cut(s) 52
BauI CACGAG 1 cut(s) 198
BccI CCATC 1 cut(s) 29
BciT130I CCWGG 1 cut(s) 159
BfmI CTRYAG 1 cut(s) 138
BfrI CTTAAG 1 cut(s) 103
Bme1390I CCNGG 1 cut(s) 159
BmiI GGNNCC 1 cut(s) 113
BmrFI CCNGG 1 cut(s) 159
BmsI GCATC 1 cut(s) 115
BsaJI CCNNGG 1 cut(s) 189
BseBI CCWGG 1 cut(s) 159
BseDI CCNNGG 1 cut(s) 189
BseGI GGATG 1 cut(s) 35
BseMII CTCAG 1 cut(s) 66
BshFI GGCC 1 cut(s) 188
BsnI GGCC 1 cut(s) 188
BspANI GGCC 1 cut(s) 188
BspCNI CTCAG 1 cut(s) 67
BspHI TCATGA 1 cut(s) 10
BspLI GGNNCC 1 cut(s) 113
BspMAI CTGCAG 1 cut(s) 142
BspTI CTTAAG 1 cut(s) 103
BssECI CCNNGG 1 cut(s) 189
BssSI CACGAG 1 cut(s) 198
BssT1I CCWWGG 1 cut(s) 189
Bst2BI CACGAG 1 cut(s) 198
Bst2UI CCWGG 1 cut(s) 159
Bst4CI ACNGT 2 cut(s) 68, 208
Bst6I CTCTTC 1 cut(s) 141
BstAFI CTTAAG 1 cut(s) 103
BstDEI CTNAG 1 cut(s) 75
BstF5I GGATG 1 cut(s) 35
BstMWI GCNNNNNNNGC 1 cut(s) 194
BstNI CCWGG 1 cut(s) 159
BstSCI CCNGG 1 cut(s) 157
BstSFI CTRYAG 1 cut(s) 138
BsuRI GGCC 1 cut(s) 188
BtsCI GGATG 1 cut(s) 35
CciI TCATGA 1 cut(s) 10
CviAII CATG 3 cut(s) 11, 71, 116
CviJI RGCY 3 cut(s) 102, 188, 197
CviKI_1 RGCY 3 cut(s) 102, 188, 197
DdeI CTNAG 1 cut(s) 75
Eam1104I CTCTTC 1 cut(s) 141
EarI CTCTTC 1 cut(s) 141
Eco130I CCWWGG 1 cut(s) 189
Eco32I GATATC 1 cut(s) 181
EcoRI GAATTC 1 cut(s) 52
EcoRII CCWGG 1 cut(s) 157
EcoRV GATATC 1 cut(s) 181
EcoT14I CCWWGG 1 cut(s) 189
EcoT22I ATGCAT 1 cut(s) 6
ErhI CCWWGG 1 cut(s) 189
FaeI CATG 3 cut(s) 14, 74, 119
FaiI YATR 5 cut(s) 12, 72, 117, 122, 225
FatI CATG 3 cut(s) 10, 70, 115
FokI GGATG 1 cut(s) 42
HaeIII GGCC 1 cut(s) 188
Hin1II CATG 3 cut(s) 14, 74, 119
Hpy188III TCNNGA 2 cut(s) 11, 200
HpyCH4III ACNGT 2 cut(s) 68, 208
HpyCH4V TGCA 3 cut(s) 4, 128, 140
HpyF10VI GCNNNNNNNGC 1 cut(s) 194
HpyF3I CTNAG 1 cut(s) 75
Hsp92II CATG 3 cut(s) 14, 74, 119
LpnPI CCDG 3 cut(s) 110, 144, 171
LweI GCATC 1 cut(s) 115
MboII GAAGA 1 cut(s) 158
MluCI AATT 2 cut(s) 52, 213
MnlI CCTC 1 cut(s) 101
Mph1103I ATGCAT 1 cut(s) 6
MseI TTAA 2 cut(s) 104, 219
MslI CAYNNNNRTG 1 cut(s) 9
MspCI CTTAAG 1 cut(s) 103
MspR9I CCNGG 1 cut(s) 159
MvaI CCWGG 1 cut(s) 159
MwoI GCNNNNNNNGC 1 cut(s) 194
NlaIII CATG 3 cut(s) 14, 74, 119
NlaIV GGNNCC 1 cut(s) 113
NsiI ATGCAT 1 cut(s) 6
PagI TCATGA 1 cut(s) 10
Psp6I CCWGG 1 cut(s) 157
PspGI CCWGG 1 cut(s) 157
PspN4I GGNNCC 1 cut(s) 113
PstI CTGCAG 1 cut(s) 142
RseI CAYNNNNRTG 1 cut(s) 9
SaqAI TTAA 2 cut(s) 104, 219
ScrFI CCNGG 1 cut(s) 159
SetI ASST 2 cut(s) 104, 199
SfaNI GCATC 1 cut(s) 115
SfcI CTRYAG 1 cut(s) 138
SmiMI CAYNNNNRTG 1 cut(s) 9
SmlI CTYRAG 1 cut(s) 103
SmoI CTYRAG 1 cut(s) 103
Sse9I AATT 2 cut(s) 52, 213
StyD4I CCNGG 1 cut(s) 157
StyI CCWWGG 1 cut(s) 189
TaaI ACNGT 2 cut(s) 68, 208
TasI AATT 2 cut(s) 52, 213
Tru1I TTAA 2 cut(s) 104, 219
Tru9I TTAA 2 cut(s) 104, 219
Vha464I CTTAAG 1 cut(s) 103
XapI RAATTY 1 cut(s) 52
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.