MD17G1209300.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr17
Physical Location & Seq
Forward (+)
25412067 .. 25412920
854 bp
Loading structure...
UTR
Exon/CDS
Intron
MD17G1209300.v1.1.491

Sequence Viewer

Length: 393 bp
ATGTCTTCTATGCTAGGCTCTCAAGGTTTGGTCCTGGCAACTGCCATGGCCGTCTCCAGCATGCTCGTCTTTCTTCATTTCTCCAGGCAAAAGAATTTCCCACCAACCCAACTTTCCCATCAGTCTCCGAACCAAATCCCTCTACGTTCTTGCTTGTATTCAGGTGATAGGAAGAGGGAGAGGAAGAAGAAGAAAGTACATTTTGCTGAAAATATTGAGGAGGAGGAGCGAGCTGGGGATGGAGAGGAGGAAGAAGAACCGATCAGTATAGAGAAGAGCAAAGTCGAAACAAGTTGCAGAAACGAAATTCGACGAAAAATTCCGGCGAATCGAATCGCTTTGTACAACGGAATTCTCAAGAACCGCATGCAGAGGATGGAGTGTTCTCATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

131

Amino Acids

14.95

Weight (kDa)

9.3

Isoelectric Point (pI)

77.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 364
AcoI YGGCCR 1 cut(s) 48
AcsI RAATTY 4 cut(s) 94, 306, 318, 351
AfaI GTAC 2 cut(s) 198, 344
AjnI CCWGG 2 cut(s) 33, 83
AjuI GAANNNNNNNTTGG 2 cut(s) 97, 129
AloI GAACNNNNNNTCC 1 cut(s) 367
AluBI AGCT 1 cut(s) 233
AluI AGCT 1 cut(s) 233
Alw26I GTCTC 2 cut(s) 58, 129
AoxI GGCC 1 cut(s) 48
ApoI RAATTY 4 cut(s) 94, 306, 318, 351
AspS9I GGNCC 1 cut(s) 31
AsuHPI GGTGA 1 cut(s) 176
AvaII GGWCC 1 cut(s) 31
BccI CCATC 3 cut(s) 126, 233, 370
BceAI ACGGC 1 cut(s) 35
BciT130I CCWGG 2 cut(s) 35, 85
BcoDI GTCTC 2 cut(s) 58, 129
BfaI CTAG 1 cut(s) 14
Bme1390I CCNGG 2 cut(s) 35, 85
Bme18I GGWCC 1 cut(s) 31
BmgT120I GGNCC 1 cut(s) 31
BmrFI CCNGG 2 cut(s) 35, 85
BpmI CTGGAG 2 cut(s) 40, 67
BpuEI CTTGAG 2 cut(s) 6, 341
BsaJI CCNNGG 1 cut(s) 45
BseBI CCWGG 2 cut(s) 35, 85
BseDI CCNNGG 1 cut(s) 45
BseGI GGATG 2 cut(s) 244, 381
BseRI GAGGAG 4 cut(s) 233, 236, 239, 260
BseYI CCCAGC 1 cut(s) 233
BshFI GGCC 1 cut(s) 50
BsiSI CCGG 1 cut(s) 323
BsmAI GTCTC 2 cut(s) 58, 129
BsmBI CGTCTC 1 cut(s) 58
BsnI GGCC 1 cut(s) 50
Bsp1407I TGTACA 1 cut(s) 342
Bsp143I GATC 1 cut(s) 261
Bsp19I CCATGG 1 cut(s) 45
BspACI CCGC 1 cut(s) 364
BspANI GGCC 1 cut(s) 50
BspQI GCTCTTC 1 cut(s) 269
BsrGI TGTACA 1 cut(s) 342
BssECI CCNNGG 1 cut(s) 45
BssMI GATC 1 cut(s) 261
BssT1I CCWWGG 1 cut(s) 45
Bst2UI CCWGG 2 cut(s) 35, 85
Bst6I CTCTTC 2 cut(s) 167, 269
BstAUI TGTACA 1 cut(s) 342
BstC8I GCNNGC 3 cut(s) 62, 231, 368
BstDSI CCRYGG 1 cut(s) 45
BstF5I GGATG 2 cut(s) 244, 381
BstKTI GATC 1 cut(s) 264
BstMAI GTCTC 2 cut(s) 58, 129
BstMBI GATC 1 cut(s) 261
BstNI CCWGG 2 cut(s) 35, 85
BstNSI RCATGY 2 cut(s) 64, 370
BstSCI CCNGG 2 cut(s) 33, 83
BsuRI GGCC 1 cut(s) 50
BtgI CCRYGG 1 cut(s) 45
BtsCI GGATG 2 cut(s) 244, 381
Cac8I GCNNGC 3 cut(s) 62, 231, 368
Cfr13I GGNCC 1 cut(s) 31
Csp6I GTAC 2 cut(s) 197, 343
CviAII CATG 3 cut(s) 46, 61, 367
CviJI RGCY 3 cut(s) 18, 50, 233
CviKI_1 RGCY 3 cut(s) 18, 50, 233
CviQI GTAC 2 cut(s) 197, 343
DpnI GATC 1 cut(s) 263
DpnII GATC 1 cut(s) 261
EaeI YGGCCR 1 cut(s) 48
Eam1104I CTCTTC 2 cut(s) 167, 269
EarI CTCTTC 2 cut(s) 167, 269
Eco130I CCWWGG 1 cut(s) 45
Eco47I GGWCC 1 cut(s) 31
EcoRI GAATTC 1 cut(s) 351
EcoRII CCWGG 2 cut(s) 33, 83
EcoT14I CCWWGG 1 cut(s) 45
ErhI CCWWGG 1 cut(s) 45
Esp3I CGTCTC 1 cut(s) 58
FaeI CATG 3 cut(s) 49, 64, 370
FaiI YATR 5 cut(s) 11, 47, 62, 269, 368
FatI CATG 3 cut(s) 45, 60, 366
FokI GGATG 2 cut(s) 251, 388
FspBI CTAG 1 cut(s) 14
GsaI CCCAGC 1 cut(s) 237
GsuI CTGGAG 2 cut(s) 40, 67
HaeIII GGCC 1 cut(s) 50
HapII CCGG 1 cut(s) 323
Hin1II CATG 3 cut(s) 49, 64, 370
HinfI GANTC 2 cut(s) 328, 333
HpaII CCGG 1 cut(s) 323
HphI GGTGA 1 cut(s) 176
Hpy188I TCNGA 1 cut(s) 129
Hpy188III TCNNGA 1 cut(s) 358
Hpy99I CGWCG 1 cut(s) 315
HpyCH4IV ACGT 1 cut(s) 145
HpyCH4V TGCA 2 cut(s) 297, 370
HpySE526I ACGT 1 cut(s) 145
Hsp92II CATG 3 cut(s) 49, 64, 370
Kzo9I GATC 1 cut(s) 261
LguI GCTCTTC 1 cut(s) 269
LmnI GCTCC 1 cut(s) 226
LpnPI CCDG 8 cut(s) 20, 47, 70, 70, 97, 147, 219, 336
MaeI CTAG 1 cut(s) 14
MaeII ACGT 1 cut(s) 145
MalI GATC 1 cut(s) 263
MboI GATC 1 cut(s) 261
MboII GAAGA 8 cut(s) 65, 184, 196, 199, 202, 263, 266, 286
MluCI AATT 4 cut(s) 94, 306, 318, 351
MnlI CCTC 9 cut(s) 150, 168, 174, 211, 214, 217, 238, 241, 366
MspI CCGG 1 cut(s) 323
MspR9I CCNGG 2 cut(s) 35, 85
MvaI CCWGG 2 cut(s) 35, 85
NcoI CCATGG 1 cut(s) 45
NdeII GATC 1 cut(s) 261
NlaIII CATG 3 cut(s) 49, 64, 370
NspI RCATGY 2 cut(s) 64, 370
PaeI GCATGC 2 cut(s) 64, 370
PciSI GCTCTTC 1 cut(s) 269
PfeI GAWTC 2 cut(s) 328, 333
Psp6I CCWGG 2 cut(s) 33, 83
PspFI CCCAGC 1 cut(s) 233
PspGI CCWGG 2 cut(s) 33, 83
PspPI GGNCC 1 cut(s) 31
RsaI GTAC 2 cut(s) 198, 344
RsaNI GTAC 2 cut(s) 197, 343
SapI GCTCTTC 1 cut(s) 269
Sau3AI GATC 1 cut(s) 261
Sau96I GGNCC 1 cut(s) 31
ScrFI CCNGG 2 cut(s) 35, 85
SetI ASST 4 cut(s) 28, 148, 166, 235
SinI GGWCC 1 cut(s) 31
SmlI CTYRAG 2 cut(s) 21, 356
SmoI CTYRAG 2 cut(s) 21, 356
SphI GCATGC 2 cut(s) 64, 370
Sse9I AATT 4 cut(s) 94, 306, 318, 351
SsiI CCGC 1 cut(s) 364
SspI AATATT 1 cut(s) 214
SspMI CTAG 1 cut(s) 14
StyD4I CCNGG 2 cut(s) 33, 83
StyI CCWWGG 1 cut(s) 45
TaiI ACGT 1 cut(s) 148
TaqI TCGA 3 cut(s) 285, 310, 331
TasI AATT 4 cut(s) 94, 306, 318, 351
TatI WGTACW 2 cut(s) 196, 342
TfiI GAWTC 2 cut(s) 328, 333
TspDTI ATGAA 1 cut(s) 65
TspGWI ACGGA 1 cut(s) 363
VpaK11BI GGWCC 1 cut(s) 31
XapI RAATTY 4 cut(s) 94, 306, 318, 351
XceI RCATGY 2 cut(s) 64, 370
XspI CTAG 1 cut(s) 14
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.