Basic Information

Type: gene

Biological Identity

Species

prunus_persica

Chromosome

Pp01

Orthogroup ID

OG0009928

Physical Location & Seq

Genomic Coordinates Forward (+)

3592314 .. 3593660

Gene Structure 1347 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Prupe.1G051100.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 810 bp

ATGTATTTGGGGGTGATGGCAGGTCATCAAATGGGTTGGGGTATAATAGAAGAGGAGGGTTGGAGAAAGGGTCCTTGGACTGCCGAGGAAGATAGGTTGCTTATAGAATATGTAAGGGTTCATGGTGAAGGGAGATGGAATTCTGTTGCTAGGCTTGCAGGACTGAAAAGGAATGGAAAGAGCTGCAGATTGAGGTGGGTGAATTATCTGAGGCCAGACCTTAAGAGGGGGCAGATAACTCCTAATGAAGAGAGCATAATTGTAGAGCTACATGCTAGGTGGGGGAACAGATGGTCAACAATTGCAAGAAGCTTGCCTGGTAGGACTGACAATGAGATCAAGAACTACTGGAGAACCCATTTCAAGAAGAAGGCAAAAGTGCCTTCTGATGCCTCCGAGAAGGCGAAAACTCGTCTACTAAGGAGGCAGCAGTTTCACCAGCAGCAGCAACAGCAGCAGCAGCAGCAGCAACAACAACAACAACAGCAATTGCAGCTGATTAATCAAGCAGAGGTGAAAAGAATCATGGCCTTTTTGGATGAAAACGAAAATAACAAAATCTCATCCTGGCCTCAAGTGAAGCAAGACATGGACACTTCTTCTGCTGCATACCCTCACAACACAGCCGATCACCAGGAGCAAGGCTTCTTCTATTCAATGCTCAATGGCAATGTGTATGTGCCTGAAGACTCCAGCAATGAGGACAGTTTTCTGTGGGATGGTTTGTGGAACTTGGATGATGTCCATGGAAATTTTGGCACAGCAGCAGGCAAAGCTAGCTTCCACAACTTGGTGGTTCCTTTCTGTTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Myb_DNA-binding

Protein Analysis

270

Amino Acids

31.35

Weight (kDa)

8.78

Isoelectric Point (pI)

65.26

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009928)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G24310
fragaria_vesca	FvH4_4g05070
malus_domestica	MD13G1224400.v1.1 MD16G1228600.v1.1 MD16G1229600.v1.1 MD16G1229800.v1.1
prunus_persica	Prupe.1G051100_v2.0.a1 Prupe.1G051300_v2.0.a1
pyrus_communis	pycom16g19130 pycom16g19160
rosa_chinensis	RchiOBHm_Chr4g0396001
rosa_laevigata	RLG00000009582
rosa_multiflora	Rmu_co8365561.1_g000001 Rmu_sc0012989.1_g000008
rosa_roxburghii	Rroxscaffold_5G00340790
rosa_rugosa	Rorug03G0352900
rosa_samantha	Rh4AG064500 Rh4AG066100 Rh4BG063200 Rh4DG059800
rosa_wichuraiana	Rw4G005220

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	11
AccB7I	CCANNNNNTGG	1 cut(s)	790
AccI	GTMKAC	1 cut(s)	415
AcsI	RAATTY	2 cut(s)	139, 751
AcuI	CTGAAG	1 cut(s)	705
AfiI	CCNNNNNNNGG	2 cut(s)	226, 790
AflII	CTTAAG	1 cut(s)	221
AgsI	TTSAA	2 cut(s)	364, 657
AjnI	CCWGG	3 cut(s)	316, 566, 633
AjuI	GAANNNNNNNTTGG	2 cut(s)	58, 90
AluBI	AGCT	6 cut(s)	183, 268, 312, 496, 776, 780
AluI	AGCT	6 cut(s)	183, 268, 312, 496, 776, 780
AoxI	GGCC	3 cut(s)	212, 528, 569
ApoI	RAATTY	2 cut(s)	139, 751
AseI	ATTAAT	1 cut(s)	501
AspS9I	GGNCC	1 cut(s)	71
AsuHPI	GGTGA	6 cut(s)	25, 137, 211, 428, 526, 623
AsuNHI	GCTAGC	1 cut(s)	776
AvaII	GGWCC	1 cut(s)	71
BbsI	GAAGAC	1 cut(s)	693
BccI	CCATC	4 cut(s)	10, 129, 285, 713
BciT130I	CCWGG	3 cut(s)	318, 568, 635
BfaI	CTAG	3 cut(s)	150, 276, 777
BfmI	CTRYAG	1 cut(s)	184
BfrI	CTTAAG	1 cut(s)	221
BfuAI	ACCTGC	1 cut(s)	11
Bme1390I	CCNGG	3 cut(s)	318, 568, 635
Bme18I	GGWCC	1 cut(s)	71
BmgT120I	GGNCC	1 cut(s)	71
BmiI	GGNNCC	2 cut(s)	72, 798
BmrFI	CCNGG	3 cut(s)	318, 568, 635
BmsI	GCATC	1 cut(s)	379
BmtI	GCTAGC	1 cut(s)	780
BpiI	GAAGAC	1 cut(s)	693
BpmI	CTGGAG	2 cut(s)	370, 676
BpuEI	CTTGAG	1 cut(s)	558
BsaJI	CCNNGG	3 cut(s)	74, 84, 745
BsaXI	ACNNNNNCTCC	2 cut(s)	55, 85
Bsc4I	CCNNNNNNNGG	2 cut(s)	226, 790
Bse1I	ACTGG	1 cut(s)	353
Bse3DI	GCAATG	2 cut(s)	676, 703
BseBI	CCWGG	3 cut(s)	318, 568, 635
BseDI	CCNNGG	3 cut(s)	74, 84, 745
BseGI	GGATG	4 cut(s)	544, 563, 724, 742
BseLI	CCNNNNNNNGG	2 cut(s)	226, 790
BseMI	GCAATG	2 cut(s)	676, 703
BseMII	CTCAG	1 cut(s)	200
BseNI	ACTGG	1 cut(s)	353
BseRI	GAGGAG	1 cut(s)	68
BshFI	GGCC	3 cut(s)	214, 530, 571
BslI	CCNNNNNNNGG	2 cut(s)	226, 790
BsnI	GGCC	3 cut(s)	214, 530, 571
Bsp143I	GATC	2 cut(s)	336, 628
Bsp19I	CCATGG	1 cut(s)	745
BspANI	GGCC	3 cut(s)	214, 530, 571
BspCNI	CTCAG	1 cut(s)	201
BspLI	GGNNCC	2 cut(s)	72, 798
BspMAI	CTGCAG	1 cut(s)	188
BspMI	ACCTGC	1 cut(s)	11
BspOI	GCTAGC	1 cut(s)	780
BspTI	CTTAAG	1 cut(s)	221
BsrDI	GCAATG	2 cut(s)	676, 703
BsrI	ACTGG	1 cut(s)	353
BssECI	CCNNGG	3 cut(s)	74, 84, 745
BssMI	GATC	2 cut(s)	336, 628
BssT1I	CCWWGG	2 cut(s)	74, 745
Bst2UI	CCWGG	3 cut(s)	318, 568, 635
Bst4CI	ACNGT	1 cut(s)	707
Bst6I	CTCTTC	2 cut(s)	45, 243
BstAFI	CTTAAG	1 cut(s)	221
BstC8I	GCNNGC	4 cut(s)	156, 314, 769, 778
BstDEI	CTNAG	2 cut(s)	209, 419
BstDSI	CCRYGG	1 cut(s)	745
BstF5I	GGATG	4 cut(s)	544, 563, 724, 742
BstKTI	GATC	2 cut(s)	339, 631
BstMBI	GATC	2 cut(s)	336, 628
BstMWI	GCNNNNNNNGC	9 cut(s)	155, 451, 454, 460, 463, 466, 493, 773, 777
BstNI	CCWGG	3 cut(s)	318, 568, 635
BstNSI	RCATGY	1 cut(s)	275
BstSCI	CCNGG	3 cut(s)	316, 566, 633
BstSFI	CTRYAG	1 cut(s)	184
BstV2I	GAAGAC	1 cut(s)	693
BsuRI	GGCC	3 cut(s)	214, 530, 571
BtgI	CCRYGG	1 cut(s)	745
BtsCI	GGATG	4 cut(s)	544, 563, 724, 742
BveI	ACCTGC	1 cut(s)	11
Cac8I	GCNNGC	4 cut(s)	156, 314, 769, 778
Cfr13I	GGNCC	1 cut(s)	71
CviAII	CATG	5 cut(s)	122, 272, 526, 589, 746
DdeI	CTNAG	2 cut(s)	209, 419
DpnI	GATC	2 cut(s)	338, 630
DpnII	GATC	2 cut(s)	336, 628
Eam1104I	CTCTTC	2 cut(s)	45, 243
EarI	CTCTTC	2 cut(s)	45, 243
Eco130I	CCWWGG	2 cut(s)	74, 745
Eco47I	GGWCC	1 cut(s)	71
Eco57I	CTGAAG	1 cut(s)	705
EcoO109I	RGGNCCY	1 cut(s)	71
EcoRI	GAATTC	1 cut(s)	139
EcoRII	CCWGG	3 cut(s)	316, 566, 633
EcoT14I	CCWWGG	2 cut(s)	74, 745
ErhI	CCWWGG	2 cut(s)	74, 745
FaeI	CATG	5 cut(s)	125, 275, 529, 592, 749
FatI	CATG	5 cut(s)	121, 271, 525, 588, 745
FblI	GTMKAC	1 cut(s)	415
FokI	GGATG	4 cut(s)	550, 551, 731, 749
FspBI	CTAG	3 cut(s)	150, 276, 777
GsuI	CTGGAG	2 cut(s)	370, 676
HaeIII	GGCC	3 cut(s)	214, 530, 571
Hin1II	CATG	5 cut(s)	125, 275, 529, 592, 749
HincII	GTYRAC	1 cut(s)	297
HindII	GTYRAC	1 cut(s)	297
HindIII	AAGCTT	1 cut(s)	310
HinfI	GANTC	2 cut(s)	522, 689
HphI	GGTGA	6 cut(s)	25, 137, 211, 428, 526, 623
Hpy166II	GTNNAC	2 cut(s)	297, 416
Hpy188I	TCNGA	3 cut(s)	210, 388, 397
Hpy188III	TCNNGA	2 cut(s)	340, 364
Hpy8I	GTNNAC	2 cut(s)	297, 416
HpyAV	CCTTC	4 cut(s)	122, 364, 393, 394
HpyCH4III	ACNGT	1 cut(s)	707
HpyCH4V	TGCA	5 cut(s)	158, 186, 305, 493, 608
HpyF10VI	GCNNNNNNNGC	9 cut(s)	155, 451, 454, 460, 463, 466, 493, 773, 777
HpyF3I	CTNAG	2 cut(s)	209, 419
Hsp92II	CATG	5 cut(s)	125, 275, 529, 592, 749
Kzo9I	GATC	2 cut(s)	336, 628
LmnI	GCTCC	1 cut(s)	637
LweI	GCATC	1 cut(s)	379
MaeI	CTAG	3 cut(s)	150, 276, 777
MalI	GATC	2 cut(s)	338, 630
MboI	GATC	2 cut(s)	336, 628
MboII	GAAGA	7 cut(s)	62, 101, 260, 379, 591, 640, 698
MfeI	CAATTG	2 cut(s)	300, 488
MluCI	AATT	6 cut(s)	139, 202, 258, 300, 488, 751
MlyI	GAGTC	1 cut(s)	683
MmeI	TCCRAC	1 cut(s)	41
MseI	TTAA	3 cut(s)	222, 501, 808
MspA1I	CMGCKG	1 cut(s)	496
MspCI	CTTAAG	1 cut(s)	221
MspR9I	CCNGG	3 cut(s)	318, 568, 635
MunI	CAATTG	2 cut(s)	300, 488
MvaI	CCWGG	3 cut(s)	318, 568, 635
MwoI	GCNNNNNNNGC	9 cut(s)	155, 451, 454, 460, 463, 466, 493, 773, 777
NcoI	CCATGG	1 cut(s)	745
NdeII	GATC	2 cut(s)	336, 628
NheI	GCTAGC	1 cut(s)	776
NlaIII	CATG	5 cut(s)	125, 275, 529, 592, 749
NlaIV	GGNNCC	2 cut(s)	72, 798
NmeAIII	GCCGAG	1 cut(s)	109
NspI	RCATGY	1 cut(s)	275
PfeI	GAWTC	1 cut(s)	522
PflMI	CCANNNNNTGG	1 cut(s)	790
PleI	GAGTC	1 cut(s)	683
PpsI	GAGTC	1 cut(s)	683
PpuMI	RGGWCCY	1 cut(s)	71
PshBI	ATTAAT	1 cut(s)	501
Psp5II	RGGWCCY	1 cut(s)	71
Psp6I	CCWGG	3 cut(s)	316, 566, 633
PspGI	CCWGG	3 cut(s)	316, 566, 633
PspN4I	GGNNCC	2 cut(s)	72, 798
PspPI	GGNCC	1 cut(s)	71
PspPPI	RGGWCCY	1 cut(s)	71
PstI	CTGCAG	1 cut(s)	188
PvuII	CAGCTG	1 cut(s)	496
SaqAI	TTAA	3 cut(s)	222, 501, 808
Sau3AI	GATC	2 cut(s)	336, 628
Sau96I	GGNCC	1 cut(s)	71
SchI	GAGTC	1 cut(s)	683
ScrFI	CCNGG	3 cut(s)	318, 568, 635
SfaNI	GCATC	1 cut(s)	379
SfcI	CTRYAG	1 cut(s)	184
SinI	GGWCC	1 cut(s)	71
SmlI	CTYRAG	2 cut(s)	221, 573
SmoI	CTYRAG	2 cut(s)	221, 573
Sse9I	AATT	6 cut(s)	139, 202, 258, 300, 488, 751
SspMI	CTAG	3 cut(s)	150, 276, 777
StyD4I	CCNGG	3 cut(s)	316, 566, 633
StyI	CCWWGG	2 cut(s)	74, 745
TaaI	ACNGT	1 cut(s)	707
TasI	AATT	6 cut(s)	139, 202, 258, 300, 488, 751
TfiI	GAWTC	1 cut(s)	522
Tru1I	TTAA	3 cut(s)	222, 501, 808
Tru9I	TTAA	3 cut(s)	222, 501, 808
TspDTI	ATGAA	3 cut(s)	110, 261, 555
Van91I	CCANNNNNTGG	1 cut(s)	790
Vha464I	CTTAAG	1 cut(s)	221
VpaK11BI	GGWCC	1 cut(s)	71
VspI	ATTAAT	1 cut(s)	501
XapI	RAATTY	2 cut(s)	139, 751
XceI	RCATGY	1 cut(s)	275
XcmI	CCANNNNNNNNNTGG	1 cut(s)	752
XmiI	GTMKAC	1 cut(s)	415
XspI	CTAG	3 cut(s)	150, 276, 777

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.