Prupe.1G051300_v2.0.a1
MYB Family

transcription factor

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
OG0009928
Physical Location & Seq
Forward (+)
3601947 .. 3603229
1283 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G051300.1

Sequence Viewer

Length: 765 bp
ATGTATTTGGGGATGATGGCAGGTCATCATATGGGTTGGGGTATAATAGAAGAAGAGGGTTGGAGAAAGGGACCTTGGACTGCTGAGGAAGATGGGTTGCTTACTGAGTATGTAAAGCTTCATGGTGAAGGAAGATGGAACTCTGTGGCTAGGCTTGCAGGACTGAAAAGGAATGGAAAGAGTTGCAGATTGAGATGGGTGAATTACTTGAGGCCAGAACTTAAGAGGGGGCAAATAACTCCACATGAAGAGAGCATAATTCTAGAGCTACATGCTAGATGGGGGAATAGGTGGTCAACAATCGCAAGAAGCTTGCCTGGAAGGACTGACAATGAGATCAAGAACTACTGGAGAACCCATTTCAAGAAAAAGGCAAAAGTGCCTTCCGATGCCTCCGAAAAGGCGAAAAATCGCTTCTTGAGGAGGAAGCAATTTCACAATCAGCAACATCAGCAGCAACAACAACATTTACAAGTGAATCAAGAAGAAGTGAAAAGAATCTTGGCCTTGCTGGATGAAAATAATGACACTAAAATGCCATGCTTCTGGCCTCAAGTTAAGCAAGGCATGGAGACTATAAGTACATATCCTCATCACACAACTGATCACCAGGAGCAATGCTTCAACTATTCCATGCTCAATGGAAATGTGTCTGTGCCTGAAGCCTCCAATAATGAGGACAATTTTCTGTGGGATGGTTTGTGGAACTTGAATGATGTCCATGGCAATTTTAACTCAACATGTGCAACAGGAAAAGCTAGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Myb_DNA-binding

Protein Analysis

255

Amino Acids

29.67

Weight (kDa)

8.99

Isoelectric Point (pI)

55.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 11
AcuI CTGAAG 1 cut(s) 681
AfaI GTAC 1 cut(s) 583
AflII CTTAAG 1 cut(s) 221
AflIII ACRYGT 1 cut(s) 740
AgsI TTSAA 3 cut(s) 364, 625, 712
AjnI CCWGG 2 cut(s) 316, 609
AjuI GAANNNNNNNTTGG 4 cut(s) 58, 90, 485, 517
AluBI AGCT 5 cut(s) 118, 268, 312, 758, 762
AluI AGCT 5 cut(s) 118, 268, 312, 758, 762
Alw26I GTCTC 1 cut(s) 566
AoxI GGCC 3 cut(s) 212, 504, 548
ApeKI GCWGC 1 cut(s) 454
AspS9I GGNCC 1 cut(s) 71
AsuHPI GGTGA 3 cut(s) 137, 211, 599
AsuNHI GCTAGC 1 cut(s) 758
AvaII GGWCC 1 cut(s) 71
BbvCI CCTCAGC 1 cut(s) 84
BbvI GCAGC 1 cut(s) 466
BccI CCATC 6 cut(s) 10, 86, 129, 189, 273, 689
BciT130I CCWGG 2 cut(s) 318, 611
BclI TGATCA 1 cut(s) 604
BcoDI GTCTC 1 cut(s) 566
BfaI CTAG 5 cut(s) 150, 263, 276, 759, 763
BfrI CTTAAG 1 cut(s) 221
BfuAI ACCTGC 1 cut(s) 11
BisI GCNGC 1 cut(s) 455
BlsI GCNGC 1 cut(s) 456
Bme1390I CCNGG 2 cut(s) 318, 611
Bme18I GGWCC 1 cut(s) 71
BmgT120I GGNCC 1 cut(s) 71
BmiI GGNNCC 1 cut(s) 72
BmrFI CCNGG 2 cut(s) 318, 611
BmsI GCATC 1 cut(s) 379
BmtI GCTAGC 1 cut(s) 762
BpmI CTGGAG 1 cut(s) 370
Bpu10I CCTNAGC 1 cut(s) 84
BpuEI CTTGAG 3 cut(s) 229, 439, 537
BsaJI CCNNGG 2 cut(s) 74, 721
Bse1I ACTGG 1 cut(s) 353
Bse3DI GCAATG 1 cut(s) 623
BseBI CCWGG 2 cut(s) 318, 611
BseDI CCNNGG 2 cut(s) 74, 721
BseGI GGATG 3 cut(s) 18, 520, 700
BseMI GCAATG 1 cut(s) 623
BseMII CTCAG 2 cut(s) 75, 96
BseNI ACTGG 1 cut(s) 353
BseRI GAGGAG 1 cut(s) 436
BseXI GCAGC 1 cut(s) 466
BshFI GGCC 3 cut(s) 214, 506, 550
BslFI GGGAC 1 cut(s) 84
BsmAI GTCTC 1 cut(s) 566
BsmFI GGGAC 1 cut(s) 84
BsnI GGCC 3 cut(s) 214, 506, 550
Bsp143I GATC 2 cut(s) 336, 604
Bsp19I CCATGG 1 cut(s) 721
BspANI GGCC 3 cut(s) 214, 506, 550
BspCNI CTCAG 2 cut(s) 76, 97
BspLI GGNNCC 1 cut(s) 72
BspMI ACCTGC 1 cut(s) 11
BspOI GCTAGC 1 cut(s) 762
BspTI CTTAAG 1 cut(s) 221
BsrDI GCAATG 1 cut(s) 623
BsrI ACTGG 1 cut(s) 353
BssECI CCNNGG 2 cut(s) 74, 721
BssMI GATC 2 cut(s) 336, 604
BssT1I CCWWGG 2 cut(s) 74, 721
Bst2UI CCWGG 2 cut(s) 318, 611
Bst6I CTCTTC 2 cut(s) 48, 243
BstAFI CTTAAG 1 cut(s) 221
BstC8I GCNNGC 3 cut(s) 156, 314, 760
BstDEI CTNAG 2 cut(s) 84, 105
BstDSI CCRYGG 1 cut(s) 721
BstF5I GGATG 3 cut(s) 18, 520, 700
BstKTI GATC 2 cut(s) 339, 607
BstMAI GTCTC 1 cut(s) 566
BstMBI GATC 2 cut(s) 336, 604
BstMWI GCNNNNNNNGC 2 cut(s) 155, 451
BstNI CCWGG 2 cut(s) 318, 611
BstNSI RCATGY 2 cut(s) 275, 744
BstSCI CCNGG 2 cut(s) 316, 609
BstV1I GCAGC 1 cut(s) 466
BstXI CCANNNNNNTGG 1 cut(s) 546
BsuRI GGCC 3 cut(s) 214, 506, 550
BtgI CCRYGG 1 cut(s) 721
BtsCI GGATG 3 cut(s) 18, 520, 700
BveI ACCTGC 1 cut(s) 11
Cac8I GCNNGC 3 cut(s) 156, 314, 760
Cfr13I GGNCC 1 cut(s) 71
Csp6I GTAC 1 cut(s) 582
CviAII CATG 8 cut(s) 122, 245, 272, 540, 568, 634, 722, 741
CviQI GTAC 1 cut(s) 582
DdeI CTNAG 2 cut(s) 84, 105
DpnI GATC 2 cut(s) 338, 606
DpnII GATC 2 cut(s) 336, 604
Eam1104I CTCTTC 2 cut(s) 48, 243
EarI CTCTTC 2 cut(s) 48, 243
Eco130I CCWWGG 2 cut(s) 74, 721
Eco47I GGWCC 1 cut(s) 71
Eco57I CTGAAG 1 cut(s) 681
EcoO109I RGGNCCY 1 cut(s) 71
EcoRII CCWGG 2 cut(s) 316, 609
EcoT14I CCWWGG 2 cut(s) 74, 721
ErhI CCWWGG 2 cut(s) 74, 721
FaeI CATG 8 cut(s) 125, 248, 275, 543, 571, 637, 725, 744
FaqI GGGAC 1 cut(s) 84
FatI CATG 8 cut(s) 121, 244, 271, 539, 567, 633, 721, 740
FauNDI CATATG 1 cut(s) 30
FbaI TGATCA 1 cut(s) 604
Fnu4HI GCNGC 1 cut(s) 455
FokI GGATG 3 cut(s) 25, 527, 707
Fsp4HI GCNGC 1 cut(s) 455
FspBI CTAG 5 cut(s) 150, 263, 276, 759, 763
GluI GCNGC 1 cut(s) 455
GsuI CTGGAG 1 cut(s) 370
HaeIII GGCC 3 cut(s) 214, 506, 550
Hin1II CATG 8 cut(s) 125, 248, 275, 543, 571, 637, 725, 744
HincII GTYRAC 1 cut(s) 297
HindII GTYRAC 1 cut(s) 297
HindIII AAGCTT 2 cut(s) 116, 310
HinfI GANTC 2 cut(s) 478, 498
HphI GGTGA 3 cut(s) 137, 211, 599
Hpy166II GTNNAC 1 cut(s) 297
Hpy188I TCNGA 2 cut(s) 388, 397
Hpy188III TCNNGA 5 cut(s) 263, 340, 364, 418, 482
Hpy8I GTNNAC 1 cut(s) 297
HpyAV CCTTC 3 cut(s) 122, 315, 393
HpyCH4V TGCA 3 cut(s) 158, 186, 746
HpyF10VI GCNNNNNNNGC 2 cut(s) 155, 451
HpyF3I CTNAG 2 cut(s) 84, 105
Hsp92II CATG 8 cut(s) 125, 248, 275, 543, 571, 637, 725, 744
Ksp22I TGATCA 1 cut(s) 604
Kzo9I GATC 2 cut(s) 336, 604
LmnI GCTCC 1 cut(s) 613
Lsp1109I GCAGC 1 cut(s) 466
LweI GCATC 1 cut(s) 379
MaeI CTAG 5 cut(s) 150, 263, 276, 759, 763
MalI GATC 2 cut(s) 338, 606
MboI GATC 2 cut(s) 336, 604
MboII GAAGA 6 cut(s) 62, 65, 101, 144, 260, 497
MluCI AATT 5 cut(s) 202, 258, 431, 682, 727
MmeI TCCRAC 1 cut(s) 41
MseI TTAA 3 cut(s) 222, 558, 732
MslI CAYNNNNRTG 1 cut(s) 533
MspCI CTTAAG 1 cut(s) 221
MspR9I CCNGG 2 cut(s) 318, 611
MvaI CCWGG 2 cut(s) 318, 611
MwoI GCNNNNNNNGC 2 cut(s) 155, 451
NcoI CCATGG 1 cut(s) 721
NdeI CATATG 1 cut(s) 30
NdeII GATC 2 cut(s) 336, 604
NheI GCTAGC 1 cut(s) 758
NlaIII CATG 8 cut(s) 125, 248, 275, 543, 571, 637, 725, 744
NlaIV GGNNCC 1 cut(s) 72
NspI RCATGY 2 cut(s) 275, 744
PciI ACATGT 1 cut(s) 740
PfeI GAWTC 2 cut(s) 478, 498
PkrI GCNGC 1 cut(s) 456
PpuMI RGGWCCY 1 cut(s) 71
PscI ACATGT 1 cut(s) 740
Psp5II RGGWCCY 1 cut(s) 71
Psp6I CCWGG 2 cut(s) 316, 609
PspGI CCWGG 2 cut(s) 316, 609
PspN4I GGNNCC 1 cut(s) 72
PspPI GGNCC 1 cut(s) 71
PspPPI RGGWCCY 1 cut(s) 71
RsaI GTAC 1 cut(s) 583
RsaNI GTAC 1 cut(s) 582
RseI CAYNNNNRTG 1 cut(s) 533
SaqAI TTAA 3 cut(s) 222, 558, 732
SatI GCNGC 1 cut(s) 455
Sau3AI GATC 2 cut(s) 336, 604
Sau96I GGNCC 1 cut(s) 71
ScrFI CCNGG 2 cut(s) 318, 611
SetI ASST 8 cut(s) 25, 76, 120, 270, 293, 314, 760, 764
SfaNI GCATC 1 cut(s) 379
SinI GGWCC 1 cut(s) 71
SmiMI CAYNNNNRTG 1 cut(s) 533
SmlI CTYRAG 4 cut(s) 208, 221, 418, 552
SmoI CTYRAG 4 cut(s) 208, 221, 418, 552
Sse9I AATT 5 cut(s) 202, 258, 431, 682, 727
SspMI CTAG 5 cut(s) 150, 263, 276, 759, 763
StyD4I CCNGG 2 cut(s) 316, 609
StyI CCWWGG 2 cut(s) 74, 721
TasI AATT 5 cut(s) 202, 258, 431, 682, 727
TatI WGTACW 1 cut(s) 581
TfiI GAWTC 2 cut(s) 478, 498
Tru1I TTAA 3 cut(s) 222, 558, 732
Tru9I TTAA 3 cut(s) 222, 558, 732
TseI GCWGC 1 cut(s) 454
TspDTI ATGAA 3 cut(s) 110, 261, 531
Vha464I CTTAAG 1 cut(s) 221
VpaK11BI GGWCC 1 cut(s) 71
XbaI TCTAGA 1 cut(s) 262
XceI RCATGY 2 cut(s) 275, 744
XspI CTAG 5 cut(s) 150, 263, 276, 759, 763
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.