Rh4AG064500
MYB Family

transcription factor

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
Physical Location & Seq
Forward (+)
13757003 .. 13757568
566 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG064500.1

Sequence Viewer

Length: 291 bp
ATGTATTGTGGGATGATGGCAGCTCATATGGGTTGGGGAATAATAGAAGAAGAGGGTTGGAGAAAGGGTCCTTGGACTTCTGAGGAAGATAGATTGCTTATTGAGTATGTAAGGCTTCATGGTGAAGGAAGATGGAACTCTGTGGCTAGGCTTGCAGGACTGAAAAGAAATGGAAAGAGCTGCAGACTGAGGTGGGTGAATTATCTGAGGCCAGACCTTAAGAGGGGGCAGATAACTCCTCATGAAGAGAGCATAATTCTAGAGCTACATGCTAGGTGGGGGAACAGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

96

Amino Acids

11.33

Weight (kDa)

9.44

Isoelectric Point (pI)

66.37

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Myb_DNA-binding PF00249 22 - 69 3.3e-19 Myb-like DNA-binding domain
Myb_DNA-bind_6 PF13921 25 - 83 1.1e-14 Myb-like DNA-binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 223
AflII CTTAAG 1 cut(s) 218
AjuI GAANNNNNNNTTGG 2 cut(s) 55, 87
AluBI AGCT 3 cut(s) 23, 180, 265
AluI AGCT 3 cut(s) 23, 180, 265
AoxI GGCC 1 cut(s) 209
ApeKI GCWGC 2 cut(s) 20, 180
AspS9I GGNCC 1 cut(s) 68
AsuHPI GGTGA 2 cut(s) 134, 208
AvaII GGWCC 1 cut(s) 68
BbvI GCAGC 2 cut(s) 32, 167
BccI CCATC 2 cut(s) 10, 126
BfaI CTAG 3 cut(s) 147, 260, 273
BfmI CTRYAG 1 cut(s) 181
BfrI CTTAAG 1 cut(s) 218
BisI GCNGC 2 cut(s) 21, 181
BlsI GCNGC 2 cut(s) 22, 182
Bme18I GGWCC 1 cut(s) 68
BmgT120I GGNCC 1 cut(s) 68
BmiI GGNNCC 1 cut(s) 69
BsaJI CCNNGG 1 cut(s) 71
BsaXI ACNNNNNCTCC 2 cut(s) 52, 82
Bsc4I CCNNNNNNNGG 1 cut(s) 223
BseDI CCNNGG 1 cut(s) 71
BseGI GGATG 1 cut(s) 18
BseLI CCNNNNNNNGG 1 cut(s) 223
BseMII CTCAG 3 cut(s) 72, 179, 197
BseRI GAGGAG 1 cut(s) 228
BseXI GCAGC 2 cut(s) 32, 167
BshFI GGCC 1 cut(s) 211
BslI CCNNNNNNNGG 1 cut(s) 223
BsnI GGCC 1 cut(s) 211
BspANI GGCC 1 cut(s) 211
BspCNI CTCAG 3 cut(s) 73, 180, 198
BspHI TCATGA 1 cut(s) 241
BspLI GGNNCC 1 cut(s) 69
BspMAI CTGCAG 1 cut(s) 185
BspTI CTTAAG 1 cut(s) 218
BssECI CCNNGG 1 cut(s) 71
BssT1I CCWWGG 1 cut(s) 71
Bst6I CTCTTC 2 cut(s) 45, 240
BstAFI CTTAAG 1 cut(s) 218
BstC8I GCNNGC 1 cut(s) 153
BstDEI CTNAG 3 cut(s) 81, 188, 206
BstF5I GGATG 1 cut(s) 18
BstMWI GCNNNNNNNGC 1 cut(s) 152
BstNSI RCATGY 1 cut(s) 272
BstSFI CTRYAG 1 cut(s) 181
BstV1I GCAGC 2 cut(s) 32, 167
BsuRI GGCC 1 cut(s) 211
BtsCI GGATG 1 cut(s) 18
Cac8I GCNNGC 1 cut(s) 153
CciI TCATGA 1 cut(s) 241
Cfr13I GGNCC 1 cut(s) 68
CviAII CATG 3 cut(s) 119, 242, 269
CviJI RGCY 7 cut(s) 23, 115, 146, 151, 180, 211, 265
CviKI_1 RGCY 7 cut(s) 23, 115, 146, 151, 180, 211, 265
DdeI CTNAG 3 cut(s) 81, 188, 206
Eam1104I CTCTTC 2 cut(s) 45, 240
EarI CTCTTC 2 cut(s) 45, 240
Eco130I CCWWGG 1 cut(s) 71
Eco47I GGWCC 1 cut(s) 68
EcoO109I RGGNCCY 1 cut(s) 68
EcoT14I CCWWGG 1 cut(s) 71
ErhI CCWWGG 1 cut(s) 71
FaeI CATG 3 cut(s) 122, 245, 272
FaiI YATR 7 cut(s) 27, 29, 108, 120, 243, 254, 270
FatI CATG 3 cut(s) 118, 241, 268
FauNDI CATATG 1 cut(s) 27
Fnu4HI GCNGC 2 cut(s) 21, 181
FokI GGATG 1 cut(s) 25
Fsp4HI GCNGC 2 cut(s) 21, 181
FspBI CTAG 3 cut(s) 147, 260, 273
GluI GCNGC 2 cut(s) 21, 181
HaeIII GGCC 1 cut(s) 211
Hin1II CATG 3 cut(s) 122, 245, 272
HphI GGTGA 2 cut(s) 134, 208
Hpy188I TCNGA 2 cut(s) 82, 207
Hpy188III TCNNGA 2 cut(s) 242, 260
HpyAV CCTTC 1 cut(s) 119
HpyCH4V TGCA 2 cut(s) 155, 183
HpyF10VI GCNNNNNNNGC 1 cut(s) 152
HpyF3I CTNAG 3 cut(s) 81, 188, 206
Hsp92II CATG 3 cut(s) 122, 245, 272
LpnPI CCDG 3 cut(s) 141, 225, 271
Lsp1109I GCAGC 2 cut(s) 32, 167
MaeI CTAG 3 cut(s) 147, 260, 273
MboII GAAGA 5 cut(s) 59, 62, 98, 141, 257
MluCI AATT 2 cut(s) 199, 255
MmeI TCCRAC 1 cut(s) 38
MnlI CCTC 6 cut(s) 46, 76, 183, 201, 216, 249
MseI TTAA 1 cut(s) 219
MspCI CTTAAG 1 cut(s) 218
MwoI GCNNNNNNNGC 1 cut(s) 152
NdeI CATATG 1 cut(s) 27
NlaIII CATG 3 cut(s) 122, 245, 272
NlaIV GGNNCC 1 cut(s) 69
NspI RCATGY 1 cut(s) 272
PagI TCATGA 1 cut(s) 241
PkrI GCNGC 2 cut(s) 22, 182
PpuMI RGGWCCY 1 cut(s) 68
Psp5II RGGWCCY 1 cut(s) 68
PspN4I GGNNCC 1 cut(s) 69
PspPI GGNCC 1 cut(s) 68
PspPPI RGGWCCY 1 cut(s) 68
PstI CTGCAG 1 cut(s) 185
SaqAI TTAA 1 cut(s) 219
SatI GCNGC 2 cut(s) 21, 181
Sau96I GGNCC 1 cut(s) 68
SetI ASST 7 cut(s) 25, 182, 194, 219, 267, 278, 290
SfcI CTRYAG 1 cut(s) 181
SinI GGWCC 1 cut(s) 68
SmlI CTYRAG 1 cut(s) 218
SmoI CTYRAG 1 cut(s) 218
Sse9I AATT 2 cut(s) 199, 255
SspMI CTAG 3 cut(s) 147, 260, 273
StyI CCWWGG 1 cut(s) 71
TasI AATT 2 cut(s) 199, 255
Tru1I TTAA 1 cut(s) 219
Tru9I TTAA 1 cut(s) 219
TseI GCWGC 2 cut(s) 20, 180
TspDTI ATGAA 2 cut(s) 107, 258
Vha464I CTTAAG 1 cut(s) 218
VpaK11BI GGWCC 1 cut(s) 68
XbaI TCTAGA 1 cut(s) 259
XceI RCATGY 1 cut(s) 272
XspI CTAG 3 cut(s) 147, 260, 273
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.