Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0012989.1

Orthogroup ID

OG0009928

Physical Location & Seq

Genomic Coordinates Forward (+)

39078 .. 40268

Gene Structure 1191 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0012989.1_g000008.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 789 bp

atggcagctcatatgggttggggaataatagaagaagagggttggagaaagggtccttggacttctgaggaagatagattgcttattgagtatgtaaggcttcatggtgaaggaagatggaactctgtggctaggcttgcaggactgaaaagaaatggaaagagctgcagactgaggtgggtgaattatctgaggccagaccttaagagggggcagataactcctcatgaagagagcataattctagagctacatgctaggtgggggaacaggtggtcaacgattgcaagaagcttgcctgggaggactgataatgagatcaagaactactggaggacccatttcaagaaaaaggccaaagtaccttctgatgcctctgagaaggccaaaactcgcctcttacggcggcaacagtttcatcatcaacagcagcagcagcaacaattgcagctgattaatcaagcagacatgaaaagaatcatggccttgctggatgaaaatgacaccaaaatatcgtcgtggccacctcaagcagcccaaggtaagcaggacgtggacactagtactatagcataccctaatcacacaattactgaggagcaaggcttcttctattctatgctcaatggtaatgtgcctcaacaagttgctgaagcttcttccagcgaggacagttttctgtgggatggcttgtggaacttggatgatgtccatgtcaattttaccacttcatcttgtgcaacaggcaaagctagtacttttcacaactttgtggttcccttttgttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Myb_DNA-binding

Protein Analysis

262

Amino Acids

30.3

Weight (kDa)

8.94

Isoelectric Point (pI)

61.87

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009928)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G24310
fragaria_vesca	FvH4_4g05070
malus_domestica	MD13G1224400.v1.1 MD16G1228600.v1.1 MD16G1229600.v1.1 MD16G1229800.v1.1
prunus_persica	Prupe.1G051100_v2.0.a1 Prupe.1G051300_v2.0.a1
pyrus_communis	pycom16g19130 pycom16g19160
rosa_chinensis	RchiOBHm_Chr4g0396001
rosa_laevigata	RLG00000009582
rosa_multiflora	Rmu_co8365561.1_g000001 Rmu_sc0012989.1_g000008
rosa_roxburghii	Rroxscaffold_5G00340790
rosa_rugosa	Rorug03G0352900
rosa_samantha	Rh4AG064500 Rh4AG066100 Rh4BG063200 Rh4DG059800
rosa_wichuraiana	Rw4G005220

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	406
AcoI	YGGCCR	1 cut(s)	521
AcuI	CTGAAG	1 cut(s)	672
AfaI	GTAC	3 cut(s)	363, 565, 757
AfiI	CCNNNNNNNGG	1 cut(s)	208
AflII	CTTAAG	1 cut(s)	203
AgsI	TTSAA	1 cut(s)	346
AhlI	ACTAGT	1 cut(s)	560
AjiI	CACGTC	1 cut(s)	553
AjnI	CCWGG	1 cut(s)	298
AjuI	GAANNNNNNNTTGG	2 cut(s)	40, 72
AluBI	AGCT	7 cut(s)	8, 165, 250, 294, 451, 656, 752
AluI	AGCT	7 cut(s)	8, 165, 250, 294, 451, 656, 752
AoxI	GGCC	5 cut(s)	194, 354, 384, 483, 521
ApeKI	GCWGC	7 cut(s)	5, 165, 430, 433, 436, 448, 533
AseI	ATTAAT	1 cut(s)	456
AspS9I	GGNCC	2 cut(s)	53, 336
AsuHPI	GGTGA	2 cut(s)	119, 193
AvaII	GGWCC	2 cut(s)	53, 336
BalI	TGGCCA	1 cut(s)	523
BbvI	GCAGC	7 cut(s)	17, 152, 442, 445, 448, 460, 545
BccI	CCATC	2 cut(s)	111, 680
BceAI	ACGGC	1 cut(s)	419
BciT130I	CCWGG	1 cut(s)	300
BcuI	ACTAGT	1 cut(s)	560
BfaI	CTAG	5 cut(s)	132, 245, 258, 561, 753
BfmI	CTRYAG	2 cut(s)	166, 567
BfrI	CTTAAG	1 cut(s)	203
BisI	GCNGC	8 cut(s)	6, 166, 407, 431, 434, 437, 449, 534
BlsI	GCNGC	8 cut(s)	7, 167, 408, 432, 435, 438, 450, 535
BmcAI	AGTACT	2 cut(s)	565, 757
Bme1390I	CCNGG	1 cut(s)	300
Bme18I	GGWCC	2 cut(s)	53, 336
BmgBI	CACGTC	1 cut(s)	553
BmgT120I	GGNCC	2 cut(s)	53, 336
BmiI	GGNNCC	3 cut(s)	54, 338, 777
BmrFI	CCNGG	1 cut(s)	300
BmsI	GCATC	1 cut(s)	361
BpmI	CTGGAG	1 cut(s)	352
BpuEI	CTTGAG	1 cut(s)	513
BsaJI	CCNNGG	3 cut(s)	56, 299, 538
BsaXI	ACNNNNNCTCC	2 cut(s)	37, 67
Bsc4I	CCNNNNNNNGG	1 cut(s)	208
Bse1I	ACTGG	1 cut(s)	335
BseBI	CCWGG	1 cut(s)	300
BseDI	CCNNGG	3 cut(s)	56, 299, 538
BseGI	GGATG	3 cut(s)	499, 691, 709
BseLI	CCNNNNNNNGG	1 cut(s)	208
BseMII	CTCAG	5 cut(s)	57, 164, 182, 369, 585
BseNI	ACTGG	1 cut(s)	335
BseRI	GAGGAG	2 cut(s)	213, 611
BseXI	GCAGC	7 cut(s)	17, 152, 442, 445, 448, 460, 545
BshFI	GGCC	5 cut(s)	196, 356, 386, 485, 523
BslI	CCNNNNNNNGG	1 cut(s)	208
BsnI	GGCC	5 cut(s)	196, 356, 386, 485, 523
Bsp143I	GATC	1 cut(s)	318
BspACI	CCGC	1 cut(s)	406
BspANI	GGCC	5 cut(s)	196, 356, 386, 485, 523
BspCNI	CTCAG	5 cut(s)	58, 165, 183, 370, 586
BspHI	TCATGA	1 cut(s)	226
BspLI	GGNNCC	3 cut(s)	54, 338, 777
BspMAI	CTGCAG	1 cut(s)	170
BspTI	CTTAAG	1 cut(s)	203
BsrI	ACTGG	1 cut(s)	335
BssECI	CCNNGG	3 cut(s)	56, 299, 538
BssMI	GATC	1 cut(s)	318
BssT1I	CCWWGG	2 cut(s)	56, 538
Bst2UI	CCWGG	1 cut(s)	300
Bst4CI	ACNGT	2 cut(s)	414, 674
Bst6I	CTCTTC	2 cut(s)	30, 225
BstAFI	CTTAAG	1 cut(s)	203
BstAPI	GCANNNNNTGC	1 cut(s)	445
BstC8I	GCNNGC	2 cut(s)	138, 296
BstDEI	CTNAG	5 cut(s)	66, 173, 191, 378, 594
BstF5I	GGATG	3 cut(s)	499, 691, 709
BstKTI	GATC	1 cut(s)	321
BstMBI	GATC	1 cut(s)	318
BstMWI	GCNNNNNNNGC	3 cut(s)	137, 436, 445
BstNI	CCWGG	1 cut(s)	300
BstNSI	RCATGY	1 cut(s)	257
BstSCI	CCNGG	1 cut(s)	298
BstSFI	CTRYAG	2 cut(s)	166, 567
BstV1I	GCAGC	7 cut(s)	17, 152, 442, 445, 448, 460, 545
BsuRI	GGCC	5 cut(s)	196, 356, 386, 485, 523
BtrI	CACGTC	1 cut(s)	553
BtsCI	GGATG	3 cut(s)	499, 691, 709
Cac8I	GCNNGC	2 cut(s)	138, 296
CciI	TCATGA	1 cut(s)	226
Cfr13I	GGNCC	2 cut(s)	53, 336
Csp6I	GTAC	3 cut(s)	362, 564, 756
CviAII	CATG	6 cut(s)	104, 227, 254, 469, 481, 713
CviQI	GTAC	3 cut(s)	362, 564, 756
DdeI	CTNAG	5 cut(s)	66, 173, 191, 378, 594
DpnI	GATC	1 cut(s)	320
DpnII	GATC	1 cut(s)	318
EaeI	YGGCCR	1 cut(s)	521
Eam1104I	CTCTTC	2 cut(s)	30, 225
EarI	CTCTTC	2 cut(s)	30, 225
Eco130I	CCWWGG	2 cut(s)	56, 538
Eco47I	GGWCC	2 cut(s)	53, 336
Eco57I	CTGAAG	1 cut(s)	672
EcoO109I	RGGNCCY	2 cut(s)	53, 336
EcoRII	CCWGG	1 cut(s)	298
EcoT14I	CCWWGG	2 cut(s)	56, 538
ErhI	CCWWGG	2 cut(s)	56, 538
FaeI	CATG	6 cut(s)	107, 230, 257, 472, 484, 716
FatI	CATG	6 cut(s)	103, 226, 253, 468, 480, 712
FauNDI	CATATG	1 cut(s)	12
Fnu4HI	GCNGC	8 cut(s)	6, 166, 407, 431, 434, 437, 449, 534
FokI	GGATG	3 cut(s)	506, 698, 716
Fsp4HI	GCNGC	8 cut(s)	6, 166, 407, 431, 434, 437, 449, 534
FspBI	CTAG	5 cut(s)	132, 245, 258, 561, 753
GluI	GCNGC	8 cut(s)	6, 166, 407, 431, 434, 437, 449, 534
GsuI	CTGGAG	1 cut(s)	352
HaeIII	GGCC	5 cut(s)	196, 356, 386, 485, 523
Hin1II	CATG	6 cut(s)	107, 230, 257, 472, 484, 716
HincII	GTYRAC	1 cut(s)	279
HindII	GTYRAC	1 cut(s)	279
HindIII	AAGCTT	2 cut(s)	292, 654
HinfI	GANTC	1 cut(s)	477
HphI	GGTGA	2 cut(s)	119, 193
Hpy166II	GTNNAC	2 cut(s)	279, 556
Hpy188I	TCNGA	4 cut(s)	67, 192, 370, 379
Hpy188III	TCNNGA	4 cut(s)	227, 245, 322, 346
Hpy8I	GTNNAC	2 cut(s)	279, 556
Hpy99I	CGWCG	1 cut(s)	520
HpyAV	CCTTC	3 cut(s)	104, 375, 376
HpyCH4III	ACNGT	2 cut(s)	414, 674
HpyCH4IV	ACGT	1 cut(s)	552
HpyCH4V	TGCA	5 cut(s)	140, 168, 287, 448, 740
HpyF10VI	GCNNNNNNNGC	3 cut(s)	137, 436, 445
HpyF3I	CTNAG	5 cut(s)	66, 173, 191, 378, 594
HpySE526I	ACGT	1 cut(s)	552
Hsp92II	CATG	6 cut(s)	107, 230, 257, 472, 484, 716
Kzo9I	GATC	1 cut(s)	318
LmnI	GCTCC	1 cut(s)	598
Lsp1109I	GCAGC	7 cut(s)	17, 152, 442, 445, 448, 460, 545
LweI	GCATC	1 cut(s)	361
MaeI	CTAG	5 cut(s)	132, 245, 258, 561, 753
MaeII	ACGT	1 cut(s)	552
MalI	GATC	1 cut(s)	320
MboI	GATC	1 cut(s)	318
MboII	GAAGA	7 cut(s)	44, 47, 83, 126, 242, 601, 651
MfeI	CAATTG	1 cut(s)	443
MlsI	TGGCCA	1 cut(s)	523
MluCI	AATT	5 cut(s)	184, 240, 443, 588, 718
MluNI	TGGCCA	1 cut(s)	523
MmeI	TCCRAC	1 cut(s)	23
Mox20I	TGGCCA	1 cut(s)	523
MscI	TGGCCA	1 cut(s)	523
MseI	TTAA	2 cut(s)	204, 456
Msp20I	TGGCCA	1 cut(s)	523
MspA1I	CMGCKG	1 cut(s)	451
MspCI	CTTAAG	1 cut(s)	203
MspR9I	CCNGG	1 cut(s)	300
MunI	CAATTG	1 cut(s)	443
MvaI	CCWGG	1 cut(s)	300
MwoI	GCNNNNNNNGC	3 cut(s)	137, 436, 445
NdeI	CATATG	1 cut(s)	12
NdeII	GATC	1 cut(s)	318
NlaIII	CATG	6 cut(s)	107, 230, 257, 472, 484, 716
NlaIV	GGNNCC	3 cut(s)	54, 338, 777
NspI	RCATGY	1 cut(s)	257
PagI	TCATGA	1 cut(s)	226
PfeI	GAWTC	1 cut(s)	477
PkrI	GCNGC	8 cut(s)	7, 167, 408, 432, 435, 438, 450, 535
PpuMI	RGGWCCY	2 cut(s)	53, 336
PshBI	ATTAAT	1 cut(s)	456
Psp5II	RGGWCCY	2 cut(s)	53, 336
Psp6I	CCWGG	1 cut(s)	298
PspGI	CCWGG	1 cut(s)	298
PspN4I	GGNNCC	3 cut(s)	54, 338, 777
PspPI	GGNCC	2 cut(s)	53, 336
PspPPI	RGGWCCY	2 cut(s)	53, 336
PstI	CTGCAG	1 cut(s)	170
PvuII	CAGCTG	1 cut(s)	451
RsaI	GTAC	3 cut(s)	363, 565, 757
RsaNI	GTAC	3 cut(s)	362, 564, 756
SaqAI	TTAA	2 cut(s)	204, 456
SatI	GCNGC	8 cut(s)	6, 166, 407, 431, 434, 437, 449, 534
Sau3AI	GATC	1 cut(s)	318
Sau96I	GGNCC	2 cut(s)	53, 336
ScaI	AGTACT	2 cut(s)	565, 757
ScrFI	CCNGG	1 cut(s)	300
SfaNI	GCATC	1 cut(s)	361
SfcI	CTRYAG	2 cut(s)	166, 567
SinI	GGWCC	2 cut(s)	53, 336
SmlI	CTYRAG	2 cut(s)	203, 528
SmoI	CTYRAG	2 cut(s)	203, 528
SpeI	ACTAGT	1 cut(s)	560
Sse9I	AATT	5 cut(s)	184, 240, 443, 588, 718
SsiI	CCGC	1 cut(s)	406
SspMI	CTAG	5 cut(s)	132, 245, 258, 561, 753
StyD4I	CCNGG	1 cut(s)	298
StyI	CCWWGG	2 cut(s)	56, 538
TaaI	ACNGT	2 cut(s)	414, 674
TaiI	ACGT	1 cut(s)	555
TasI	AATT	5 cut(s)	184, 240, 443, 588, 718
TatI	WGTACW	2 cut(s)	563, 755
TauI	GCSGC	1 cut(s)	409
TfiI	GAWTC	1 cut(s)	477
Tru1I	TTAA	2 cut(s)	204, 456
Tru9I	TTAA	2 cut(s)	204, 456
TseI	GCWGC	7 cut(s)	5, 165, 430, 433, 436, 448, 533
TspDTI	ATGAA	6 cut(s)	92, 243, 407, 485, 510, 720
Vha464I	CTTAAG	1 cut(s)	203
VpaK11BI	GGWCC	2 cut(s)	53, 336
VspI	ATTAAT	1 cut(s)	456
XbaI	TCTAGA	1 cut(s)	244
XceI	RCATGY	1 cut(s)	257
XspI	CTAG	5 cut(s)	132, 245, 258, 561, 753
ZrmI	AGTACT	2 cut(s)	565, 757

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.