Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8365561.1

Orthogroup ID

OG0009928

Physical Location & Seq

Genomic Coordinates Reverse (-)

246 .. 989

Gene Structure 744 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8365561.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 618 bp

ctgaggtgggtgaattatctgaggccagaccttaagagggggcagataactcctcatgaagagagcataattctagagctacatgctaggtgggggaacaggtggtcaacgattgcaagaagcttgcctgggaggactgataatgagatcaagaactactggaggacccatttcaagaaaaaggccaaagtaccttctgatgcctctgagaaggccaaaactcgcctcttacggcggcaacagtttcatcatcaacagcagcagcagcaacaattgcagctgattaatcaagcagacatgaaaagaatcatggccttgctggatgaaaatgacaccaaaatatcgtcgtggccacctcaagcagcccaaggtaagcaggacgtggacactagtactatagcataccctaatcacacaattactgaggagcaaggcttcttctattctatgctcaatggtaatgtgcctcaacaagttgctgaagcttcttccagcgaggacagttttctgtgggatggcttgtggaacttggatgatgtccatgtcaattttaccacttcatcttgtgcaacaggcaaagctagtacttttcacaactttgtggttcccttttgttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Myb_DNA-binding

Protein Analysis

205

Amino Acids

23.72

Weight (kDa)

8.56

Isoelectric Point (pI)

61.79

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009928)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G24310
fragaria_vesca	FvH4_4g05070
malus_domestica	MD13G1224400.v1.1 MD16G1228600.v1.1 MD16G1229600.v1.1 MD16G1229800.v1.1
prunus_persica	Prupe.1G051100_v2.0.a1 Prupe.1G051300_v2.0.a1
pyrus_communis	pycom16g19130 pycom16g19160
rosa_chinensis	RchiOBHm_Chr4g0396001
rosa_laevigata	RLG00000009582
rosa_multiflora	Rmu_co8365561.1_g000001 Rmu_sc0012989.1_g000008
rosa_roxburghii	Rroxscaffold_5G00340790
rosa_rugosa	Rorug03G0352900
rosa_samantha	Rh4AG064500 Rh4AG066100 Rh4BG063200 Rh4DG059800
rosa_wichuraiana	Rw4G005220

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	235
AcoI	YGGCCR	1 cut(s)	350
AcuI	CTGAAG	1 cut(s)	501
AfaI	GTAC	3 cut(s)	192, 394, 586
AfiI	CCNNNNNNNGG	1 cut(s)	37
AflII	CTTAAG	1 cut(s)	32
AgsI	TTSAA	1 cut(s)	175
AhlI	ACTAGT	1 cut(s)	389
AjiI	CACGTC	1 cut(s)	382
AjnI	CCWGG	1 cut(s)	127
AluBI	AGCT	5 cut(s)	79, 123, 280, 485, 581
AluI	AGCT	5 cut(s)	79, 123, 280, 485, 581
AoxI	GGCC	5 cut(s)	23, 183, 213, 312, 350
ApeKI	GCWGC	5 cut(s)	259, 262, 265, 277, 362
AseI	ATTAAT	1 cut(s)	285
AspS9I	GGNCC	1 cut(s)	165
AsuHPI	GGTGA	1 cut(s)	22
AvaII	GGWCC	1 cut(s)	165
BalI	TGGCCA	1 cut(s)	352
BbvI	GCAGC	5 cut(s)	271, 274, 277, 289, 374
BccI	CCATC	1 cut(s)	509
BceAI	ACGGC	1 cut(s)	248
BciT130I	CCWGG	1 cut(s)	129
BcuI	ACTAGT	1 cut(s)	389
BfaI	CTAG	4 cut(s)	74, 87, 390, 582
BfmI	CTRYAG	1 cut(s)	396
BfrI	CTTAAG	1 cut(s)	32
BisI	GCNGC	6 cut(s)	236, 260, 263, 266, 278, 363
BlsI	GCNGC	6 cut(s)	237, 261, 264, 267, 279, 364
BmcAI	AGTACT	2 cut(s)	394, 586
Bme1390I	CCNGG	1 cut(s)	129
Bme18I	GGWCC	1 cut(s)	165
BmgBI	CACGTC	1 cut(s)	382
BmgT120I	GGNCC	1 cut(s)	165
BmiI	GGNNCC	2 cut(s)	167, 606
BmrFI	CCNGG	1 cut(s)	129
BmsI	GCATC	1 cut(s)	190
BpmI	CTGGAG	1 cut(s)	181
BpuEI	CTTGAG	1 cut(s)	342
BsaJI	CCNNGG	2 cut(s)	128, 367
Bsc4I	CCNNNNNNNGG	1 cut(s)	37
Bse1I	ACTGG	1 cut(s)	164
BseBI	CCWGG	1 cut(s)	129
BseDI	CCNNGG	2 cut(s)	128, 367
BseGI	GGATG	3 cut(s)	328, 520, 538
BseLI	CCNNNNNNNGG	1 cut(s)	37
BseMII	CTCAG	3 cut(s)	11, 198, 414
BseNI	ACTGG	1 cut(s)	164
BseRI	GAGGAG	2 cut(s)	42, 440
BseXI	GCAGC	5 cut(s)	271, 274, 277, 289, 374
BshFI	GGCC	5 cut(s)	25, 185, 215, 314, 352
BslI	CCNNNNNNNGG	1 cut(s)	37
BsnI	GGCC	5 cut(s)	25, 185, 215, 314, 352
Bsp143I	GATC	1 cut(s)	147
BspACI	CCGC	1 cut(s)	235
BspANI	GGCC	5 cut(s)	25, 185, 215, 314, 352
BspCNI	CTCAG	3 cut(s)	12, 199, 415
BspHI	TCATGA	1 cut(s)	55
BspLI	GGNNCC	2 cut(s)	167, 606
BspTI	CTTAAG	1 cut(s)	32
BsrI	ACTGG	1 cut(s)	164
BssECI	CCNNGG	2 cut(s)	128, 367
BssMI	GATC	1 cut(s)	147
BssT1I	CCWWGG	1 cut(s)	367
Bst2UI	CCWGG	1 cut(s)	129
Bst4CI	ACNGT	2 cut(s)	243, 503
Bst6I	CTCTTC	1 cut(s)	54
BstAFI	CTTAAG	1 cut(s)	32
BstAPI	GCANNNNNTGC	1 cut(s)	274
BstC8I	GCNNGC	1 cut(s)	125
BstDEI	CTNAG	4 cut(s)	2, 20, 207, 423
BstF5I	GGATG	3 cut(s)	328, 520, 538
BstKTI	GATC	1 cut(s)	150
BstMBI	GATC	1 cut(s)	147
BstMWI	GCNNNNNNNGC	2 cut(s)	265, 274
BstNI	CCWGG	1 cut(s)	129
BstNSI	RCATGY	1 cut(s)	86
BstSCI	CCNGG	1 cut(s)	127
BstSFI	CTRYAG	1 cut(s)	396
BstV1I	GCAGC	5 cut(s)	271, 274, 277, 289, 374
BsuRI	GGCC	5 cut(s)	25, 185, 215, 314, 352
BtrI	CACGTC	1 cut(s)	382
BtsCI	GGATG	3 cut(s)	328, 520, 538
Cac8I	GCNNGC	1 cut(s)	125
CciI	TCATGA	1 cut(s)	55
Cfr13I	GGNCC	1 cut(s)	165
Csp6I	GTAC	3 cut(s)	191, 393, 585
CviAII	CATG	5 cut(s)	56, 83, 298, 310, 542
CviQI	GTAC	3 cut(s)	191, 393, 585
DdeI	CTNAG	4 cut(s)	2, 20, 207, 423
DpnI	GATC	1 cut(s)	149
DpnII	GATC	1 cut(s)	147
EaeI	YGGCCR	1 cut(s)	350
Eam1104I	CTCTTC	1 cut(s)	54
EarI	CTCTTC	1 cut(s)	54
Eco130I	CCWWGG	1 cut(s)	367
Eco47I	GGWCC	1 cut(s)	165
Eco57I	CTGAAG	1 cut(s)	501
EcoO109I	RGGNCCY	1 cut(s)	165
EcoRII	CCWGG	1 cut(s)	127
EcoT14I	CCWWGG	1 cut(s)	367
ErhI	CCWWGG	1 cut(s)	367
FaeI	CATG	5 cut(s)	59, 86, 301, 313, 545
FaiI	YATR	9 cut(s)	57, 68, 84, 299, 311, 398, 403, 449, 543
FatI	CATG	5 cut(s)	55, 82, 297, 309, 541
Fnu4HI	GCNGC	6 cut(s)	236, 260, 263, 266, 278, 363
FokI	GGATG	3 cut(s)	335, 527, 545
Fsp4HI	GCNGC	6 cut(s)	236, 260, 263, 266, 278, 363
FspBI	CTAG	4 cut(s)	74, 87, 390, 582
GluI	GCNGC	6 cut(s)	236, 260, 263, 266, 278, 363
GsuI	CTGGAG	1 cut(s)	181
HaeIII	GGCC	5 cut(s)	25, 185, 215, 314, 352
Hin1II	CATG	5 cut(s)	59, 86, 301, 313, 545
HincII	GTYRAC	1 cut(s)	108
HindII	GTYRAC	1 cut(s)	108
HindIII	AAGCTT	2 cut(s)	121, 483
HinfI	GANTC	1 cut(s)	306
HphI	GGTGA	1 cut(s)	22
Hpy166II	GTNNAC	2 cut(s)	108, 385
Hpy188I	TCNGA	3 cut(s)	21, 199, 208
Hpy188III	TCNNGA	4 cut(s)	56, 74, 151, 175
Hpy8I	GTNNAC	2 cut(s)	108, 385
Hpy99I	CGWCG	1 cut(s)	349
HpyAV	CCTTC	2 cut(s)	204, 205
HpyCH4III	ACNGT	2 cut(s)	243, 503
HpyCH4IV	ACGT	1 cut(s)	381
HpyCH4V	TGCA	3 cut(s)	116, 277, 569
HpyF10VI	GCNNNNNNNGC	2 cut(s)	265, 274
HpyF3I	CTNAG	4 cut(s)	2, 20, 207, 423
HpySE526I	ACGT	1 cut(s)	381
Hsp92II	CATG	5 cut(s)	59, 86, 301, 313, 545
Kzo9I	GATC	1 cut(s)	147
LmnI	GCTCC	1 cut(s)	427
LpnPI	CCDG	9 cut(s)	39, 85, 114, 141, 145, 305, 362, 505, 558
Lsp1109I	GCAGC	5 cut(s)	271, 274, 277, 289, 374
LweI	GCATC	1 cut(s)	190
MaeI	CTAG	4 cut(s)	74, 87, 390, 582
MaeII	ACGT	1 cut(s)	381
MalI	GATC	1 cut(s)	149
MboI	GATC	1 cut(s)	147
MboII	GAAGA	3 cut(s)	71, 430, 480
MfeI	CAATTG	1 cut(s)	272
MlsI	TGGCCA	1 cut(s)	352
MluCI	AATT	5 cut(s)	13, 69, 272, 417, 547
MluNI	TGGCCA	1 cut(s)	352
Mox20I	TGGCCA	1 cut(s)	352
MscI	TGGCCA	1 cut(s)	352
MseI	TTAA	2 cut(s)	33, 285
Msp20I	TGGCCA	1 cut(s)	352
MspA1I	CMGCKG	1 cut(s)	280
MspCI	CTTAAG	1 cut(s)	32
MspR9I	CCNGG	1 cut(s)	129
MunI	CAATTG	1 cut(s)	272
MvaI	CCWGG	1 cut(s)	129
MwoI	GCNNNNNNNGC	2 cut(s)	265, 274
NdeII	GATC	1 cut(s)	147
NlaIII	CATG	5 cut(s)	59, 86, 301, 313, 545
NlaIV	GGNNCC	2 cut(s)	167, 606
NspI	RCATGY	1 cut(s)	86
PagI	TCATGA	1 cut(s)	55
PfeI	GAWTC	1 cut(s)	306
PkrI	GCNGC	6 cut(s)	237, 261, 264, 267, 279, 364
PpuMI	RGGWCCY	1 cut(s)	165
PshBI	ATTAAT	1 cut(s)	285
Psp5II	RGGWCCY	1 cut(s)	165
Psp6I	CCWGG	1 cut(s)	127
PspGI	CCWGG	1 cut(s)	127
PspN4I	GGNNCC	2 cut(s)	167, 606
PspPI	GGNCC	1 cut(s)	165
PspPPI	RGGWCCY	1 cut(s)	165
PvuII	CAGCTG	1 cut(s)	280
RsaI	GTAC	3 cut(s)	192, 394, 586
RsaNI	GTAC	3 cut(s)	191, 393, 585
SaqAI	TTAA	2 cut(s)	33, 285
SatI	GCNGC	6 cut(s)	236, 260, 263, 266, 278, 363
Sau3AI	GATC	1 cut(s)	147
Sau96I	GGNCC	1 cut(s)	165
ScaI	AGTACT	2 cut(s)	394, 586
ScrFI	CCNGG	1 cut(s)	129
SfaNI	GCATC	1 cut(s)	190
SfcI	CTRYAG	1 cut(s)	396
SinI	GGWCC	1 cut(s)	165
SmlI	CTYRAG	2 cut(s)	32, 357
SmoI	CTYRAG	2 cut(s)	32, 357
SpeI	ACTAGT	1 cut(s)	389
Sse9I	AATT	5 cut(s)	13, 69, 272, 417, 547
SsiI	CCGC	1 cut(s)	235
SspMI	CTAG	4 cut(s)	74, 87, 390, 582
StyD4I	CCNGG	1 cut(s)	127
StyI	CCWWGG	1 cut(s)	367
TaaI	ACNGT	2 cut(s)	243, 503
TaiI	ACGT	1 cut(s)	384
TasI	AATT	5 cut(s)	13, 69, 272, 417, 547
TatI	WGTACW	2 cut(s)	392, 584
TauI	GCSGC	1 cut(s)	238
TfiI	GAWTC	1 cut(s)	306
Tru1I	TTAA	2 cut(s)	33, 285
Tru9I	TTAA	2 cut(s)	33, 285
TseI	GCWGC	5 cut(s)	259, 262, 265, 277, 362
TspDTI	ATGAA	5 cut(s)	72, 236, 314, 339, 549
Vha464I	CTTAAG	1 cut(s)	32
VpaK11BI	GGWCC	1 cut(s)	165
VspI	ATTAAT	1 cut(s)	285
XbaI	TCTAGA	1 cut(s)	73
XceI	RCATGY	1 cut(s)	86
XspI	CTAG	4 cut(s)	74, 87, 390, 582
ZrmI	AGTACT	2 cut(s)	394, 586

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.