Prupe.4G151600_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp04
Physical Location & Seq
Forward (+)
8660009 .. 8661355
1347 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.4G151600.2

Sequence Viewer

Length: 543 bp
ATGGGTTCTAGCACCGCACTGATCAGAAACTATGCAAGCATGAACGACCATGATCATGATGATGATTTGGGAGTTGATGAACTCATGGGATCCGACGGCGCCATTCTCAAGTCCTTATTGGAAGAACTTCAAGAGGAAGATCGAGATGAGGAGAGGTTGAATATTGTGATTCAATCTCTAGAGGCAGAATTAGTCAACATTCCAAGCACAATGGACTCCGAATCGACCGTCCAAGATGTGGAAGATGGTAACTTGTCGAACGTTGTAGGAGGCTTGGACGGTCAGGATTGCTCAGTGTCATCATCAGTTGATTTTGATCAGGTGGGATGGTTTGATGTGGATCAGGTGGCTTGCTCACCAAGCGATGACATGAATTGGTATATGGATTCTTCTTGTTGTGAGTATGAGATGGATTGTCCAGCGGCTGATTCTGAATTGGTTGATGACTATTATTGTCATGTTAGTTATGGAGTTGGGTTAGAGGAGCTTGCGTATAGCTCTTTATGGCAGGAAAATGCATATGATTCAATCATGTATGACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

181

Amino Acids

19.97

Weight (kDa)

4.05

Isoelectric Point (pI)

62.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 98
AccB7I CCANNNNNTGG 1 cut(s) 238
AciI CCGC 2 cut(s) 15, 422
AclI AACGTT 1 cut(s) 261
AclWI GGATC 3 cut(s) 84, 97, 348
AcyI GRCGYC 1 cut(s) 99
AfiI CCNNNNNNNGG 1 cut(s) 238
AgsI TTSAA 4 cut(s) 131, 160, 173, 528
AluBI AGCT 2 cut(s) 487, 498
AluI AGCT 2 cut(s) 487, 498
AlwI GGATC 3 cut(s) 84, 97, 348
AlwNI CAGNNNCTG 1 cut(s) 425
ArsI GACNNNNNNTTYG 2 cut(s) 213, 245
Asp700I GAANNNNTTC 1 cut(s) 126
AspLEI GCGC 1 cut(s) 101
AsuHPI GGTGA 1 cut(s) 348
BamHI GGATCC 1 cut(s) 89
BanI GGYRCC 1 cut(s) 98
BccI CCATC 3 cut(s) 239, 321, 403
BceAI ACGGC 1 cut(s) 112
BclI TGATCA 3 cut(s) 21, 52, 316
BfaI CTAG 2 cut(s) 9, 179
BfoI RGCGCY 1 cut(s) 102
BisI GCNGC 1 cut(s) 423
BlsI GCNGC 1 cut(s) 424
BmiI GGNNCC 2 cut(s) 91, 100
BpuEI CTTGAG 1 cut(s) 92
BsaBI GATNNNNATC 2 cut(s) 315, 339
BsaHI GRCGYC 1 cut(s) 99
BsaXI ACNNNNNCTCC 2 cut(s) 476, 506
Bsc4I CCNNNNNNNGG 1 cut(s) 238
Bse8I GATNNNNATC 2 cut(s) 315, 339
BseGI GGATG 1 cut(s) 332
BseJI GATNNNNATC 2 cut(s) 315, 339
BseLI CCNNNNNNNGG 1 cut(s) 238
BseMII CTCAG 1 cut(s) 306
BseRI GAGGAG 2 cut(s) 164, 497
Bsh1285I CGRYCG 1 cut(s) 228
BshNI GGYRCC 1 cut(s) 98
BsiEI CGRYCG 1 cut(s) 228
BslI CCNNNNNNNGG 1 cut(s) 238
Bsp143I GATC 6 cut(s) 21, 52, 89, 139, 316, 340
BspACI CCGC 2 cut(s) 15, 422
BspCNI CTCAG 1 cut(s) 305
BspHI TCATGA 1 cut(s) 55
BspLI GGNNCC 2 cut(s) 91, 100
BspPI GGATC 3 cut(s) 84, 97, 348
BspT107I GGYRCC 1 cut(s) 98
BssMI GATC 6 cut(s) 21, 52, 89, 139, 316, 340
BssNI GRCGYC 1 cut(s) 99
Bst4CI ACNGT 2 cut(s) 229, 281
BstACI GRCGYC 1 cut(s) 99
BstC8I GCNNGC 3 cut(s) 37, 352, 489
BstDEI CTNAG 1 cut(s) 292
BstF5I GGATG 1 cut(s) 332
BstH2I RGCGCY 1 cut(s) 102
BstHHI GCGC 1 cut(s) 101
BstKTI GATC 6 cut(s) 24, 55, 92, 142, 319, 343
BstMBI GATC 6 cut(s) 21, 52, 89, 139, 316, 340
BstMCI CGRYCG 1 cut(s) 228
BstMWI GCNNNNNNNGC 1 cut(s) 360
BstX2I RGATCY 1 cut(s) 89
BstYI RGATCY 1 cut(s) 89
BtgZI GCGATG 1 cut(s) 378
BtsCI GGATG 1 cut(s) 332
BtsIMutI CAGTG 2 cut(s) 17, 300
Cac8I GCNNGC 3 cut(s) 37, 352, 489
CaiI CAGNNNCTG 1 cut(s) 425
CciI TCATGA 1 cut(s) 55
CfoI GCGC 1 cut(s) 101
CviAII CATG 7 cut(s) 40, 50, 56, 85, 370, 458, 532
CviJI RGCY 5 cut(s) 273, 350, 425, 487, 498
CviKI_1 RGCY 5 cut(s) 273, 350, 425, 487, 498
DdeI CTNAG 1 cut(s) 292
DinI GGCGCC 1 cut(s) 100
DpnI GATC 6 cut(s) 23, 54, 91, 141, 318, 342
DpnII GATC 6 cut(s) 21, 52, 89, 139, 316, 340
EcoT22I ATGCAT 1 cut(s) 520
EgeI GGCGCC 1 cut(s) 100
EheI GGCGCC 1 cut(s) 100
FaeI CATG 7 cut(s) 43, 53, 59, 88, 373, 461, 535
FatI CATG 7 cut(s) 39, 49, 55, 84, 369, 457, 531
FauNDI CATATG 1 cut(s) 520
FbaI TGATCA 3 cut(s) 21, 52, 316
Fnu4HI GCNGC 1 cut(s) 423
FokI GGATG 1 cut(s) 339
Fsp4HI GCNGC 1 cut(s) 423
FspBI CTAG 2 cut(s) 9, 179
GlaI GCGC 1 cut(s) 100
GluI GCNGC 1 cut(s) 423
HaeII RGCGCY 1 cut(s) 102
HhaI GCGC 1 cut(s) 101
Hin1I GRCGYC 1 cut(s) 99
Hin1II CATG 7 cut(s) 43, 53, 59, 88, 373, 461, 535
Hin6I GCGC 1 cut(s) 99
HinP1I GCGC 1 cut(s) 99
HincII GTYRAC 1 cut(s) 196
HindII GTYRAC 1 cut(s) 196
HinfI GANTC 6 cut(s) 169, 215, 221, 386, 428, 524
HphI GGTGA 1 cut(s) 348
Hpy166II GTNNAC 1 cut(s) 196
Hpy188I TCNGA 4 cut(s) 26, 94, 220, 433
Hpy188III TCNNGA 5 cut(s) 56, 131, 143, 179, 284
Hpy8I GTNNAC 1 cut(s) 196
Hpy99I CGWCG 1 cut(s) 98
HpyCH4III ACNGT 2 cut(s) 229, 281
HpyCH4IV ACGT 1 cut(s) 261
HpyCH4V TGCA 2 cut(s) 35, 518
HpyF10VI GCNNNNNNNGC 1 cut(s) 360
HpyF3I CTNAG 1 cut(s) 292
HpySE526I ACGT 1 cut(s) 261
Hsp92I GRCGYC 1 cut(s) 99
Hsp92II CATG 7 cut(s) 43, 53, 59, 88, 373, 461, 535
HspAI GCGC 1 cut(s) 99
KasI GGCGCC 1 cut(s) 98
Ksp22I TGATCA 3 cut(s) 21, 52, 316
Kzo9I GATC 6 cut(s) 21, 52, 89, 139, 316, 340
LmnI GCTCC 1 cut(s) 484
LpnPI CCDG 5 cut(s) 269, 305, 329, 432, 494
MaeI CTAG 2 cut(s) 9, 179
MaeII ACGT 1 cut(s) 261
MaeIII GTNAC 1 cut(s) 248
MalI GATC 6 cut(s) 23, 54, 91, 141, 318, 342
MboI GATC 6 cut(s) 21, 52, 89, 139, 316, 340
MboII GAAGA 4 cut(s) 134, 149, 254, 381
MflI RGATCY 1 cut(s) 89
MluCI AATT 3 cut(s) 188, 373, 434
Mly113I GGCGCC 1 cut(s) 99
MlyI GAGTC 1 cut(s) 209
MmeI TCCRAC 1 cut(s) 117
MnlI CCTC 6 cut(s) 127, 142, 147, 175, 263, 475
Mph1103I ATGCAT 1 cut(s) 520
MroXI GAANNNNTTC 1 cut(s) 126
MslI CAYNNNNRTG 2 cut(s) 54, 60
MspA1I CMGCKG 1 cut(s) 422
MwoI GCNNNNNNNGC 1 cut(s) 360
NarI GGCGCC 1 cut(s) 99
NdeI CATATG 1 cut(s) 520
NdeII GATC 6 cut(s) 21, 52, 89, 139, 316, 340
NlaIII CATG 7 cut(s) 43, 53, 59, 88, 373, 461, 535
NlaIV GGNNCC 2 cut(s) 91, 100
NsiI ATGCAT 1 cut(s) 520
PagI TCATGA 1 cut(s) 55
PdmI GAANNNNTTC 1 cut(s) 126
PfeI GAWTC 5 cut(s) 169, 221, 386, 428, 524
PflMI CCANNNNNTGG 1 cut(s) 238
PkrI GCNGC 1 cut(s) 424
PleI GAGTC 1 cut(s) 209
PluTI GGCGCC 1 cut(s) 102
PpsI GAGTC 1 cut(s) 209
Psp1406I AACGTT 1 cut(s) 261
PspN4I GGNNCC 2 cut(s) 91, 100
PstNI CAGNNNCTG 1 cut(s) 425
PsuI RGATCY 1 cut(s) 89
RseI CAYNNNNRTG 2 cut(s) 54, 60
SatI GCNGC 1 cut(s) 423
Sau3AI GATC 6 cut(s) 21, 52, 89, 139, 316, 340
SchI GAGTC 1 cut(s) 209
SetI ASST 6 cut(s) 158, 264, 324, 348, 489, 500
SfoI GGCGCC 1 cut(s) 100
SmiMI CAYNNNNRTG 2 cut(s) 54, 60
SmlI CTYRAG 1 cut(s) 107
SmoI CTYRAG 1 cut(s) 107
Sse9I AATT 3 cut(s) 188, 373, 434
SsiI CCGC 2 cut(s) 15, 422
SspDI GGCGCC 1 cut(s) 98
SspI AATATT 1 cut(s) 163
SspMI CTAG 2 cut(s) 9, 179
TaaI ACNGT 2 cut(s) 229, 281
TaiI ACGT 1 cut(s) 264
TaqI TCGA 3 cut(s) 142, 224, 257
TasI AATT 3 cut(s) 188, 373, 434
TauI GCSGC 1 cut(s) 425
TfiI GAWTC 5 cut(s) 169, 221, 386, 428, 524
TscAI CASTG 2 cut(s) 24, 300
TspDTI ATGAA 3 cut(s) 56, 93, 386
TspRI CASTG 2 cut(s) 24, 300
Van91I CCANNNNNTGG 1 cut(s) 238
XbaI TCTAGA 1 cut(s) 178
XmnI GAANNNNTTC 1 cut(s) 126
XspI CTAG 2 cut(s) 9, 179
Zsp2I ATGCAT 1 cut(s) 520
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.