Rmu_sc0001045.1_g000019

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001045.1
Physical Location & Seq
Forward (+)
58768 .. 59268
501 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001045.1_g000019.1.cds

Sequence Viewer

Length: 501 bp
atgggttctagcaccgcacagttaagcatgatgggcgatgatgatgagttgggatttgaagccttccaaaccaacggtgccattctcatgtctttactggaagaatttcaagaagaagatagtgacgatgaggaaagagtaaatagcctaatccaatctctggaagcagaaataaccagtccaagttcagcgatggacaacaacggttcgggttatatcgactcggaattgaccatcagagatttcgaagaaggcaacgactactctgattcattagttgatagtgagttggggtggtttgatatggagcaggtcccttgctcaccaagtgatgacatgaattggtatatggattcttgtgaatataagatggattgtctcaatgactctggaatatgggttggtgattattctcatatttgctatggagctggctcagaagataatgggcacaactcaatatggcaggaaactgcatatgattcaatcatgtatgactga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

166

Amino Acids

18.59

Weight (kDa)

4.05

Isoelectric Point (pI)

60.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 301
AccB1I GGYRCC 1 cut(s) 77
AccB7I CCANNNNNTGG 1 cut(s) 160
AciI CCGC 1 cut(s) 15
AcsI RAATTY 1 cut(s) 104
AdeI CACNNNGTG 1 cut(s) 329
AfiI CCNNNNNNNGG 1 cut(s) 160
AgsI TTSAA 3 cut(s) 59, 110, 486
AluBI AGCT 1 cut(s) 431
AluI AGCT 1 cut(s) 431
Alw26I GTCTC 1 cut(s) 383
ApoI RAATTY 1 cut(s) 104
Asp700I GAANNNNTTC 1 cut(s) 105
AspS9I GGNCC 1 cut(s) 313
AsuHPI GGTGA 2 cut(s) 315, 416
AsuII TTCGAA 1 cut(s) 246
AvaII GGWCC 1 cut(s) 313
BaeGI GKGCMC 1 cut(s) 453
BanI GGYRCC 1 cut(s) 77
BccI CCATC 4 cut(s) 25, 187, 242, 364
BcoDI GTCTC 1 cut(s) 383
BfaI CTAG 1 cut(s) 9
BfuAI ACCTGC 1 cut(s) 301
Bme18I GGWCC 1 cut(s) 313
BmgT120I GGNCC 1 cut(s) 313
BmiI GGNNCC 2 cut(s) 79, 315
Bpu14I TTCGAA 1 cut(s) 246
Bsc4I CCNNNNNNNGG 1 cut(s) 160
Bse1I ACTGG 2 cut(s) 102, 177
BseLI CCNNNNNNNGG 1 cut(s) 160
BseMII CTCAG 1 cut(s) 450
BseNI ACTGG 2 cut(s) 102, 177
BseSI GKGCMC 1 cut(s) 453
BshNI GGYRCC 1 cut(s) 77
BslFI GGGAC 1 cut(s) 299
BslI CCNNNNNNNGG 1 cut(s) 160
BsmAI GTCTC 1 cut(s) 383
BsmFI GGGAC 1 cut(s) 299
Bsp119I TTCGAA 1 cut(s) 246
Bsp1286I GDGCHC 1 cut(s) 453
BspACI CCGC 1 cut(s) 15
BspCNI CTCAG 1 cut(s) 449
BspLI GGNNCC 2 cut(s) 79, 315
BspMI ACCTGC 1 cut(s) 301
BspT104I TTCGAA 1 cut(s) 246
BspT107I GGYRCC 1 cut(s) 77
BsrI ACTGG 2 cut(s) 102, 177
Bst4CI ACNGT 3 cut(s) 21, 77, 206
BstBI TTCGAA 1 cut(s) 246
BstC8I GCNNGC 1 cut(s) 433
BstDEI CTNAG 1 cut(s) 436
BstMAI GTCTC 1 cut(s) 383
BstMWI GCNNNNNNNGC 1 cut(s) 33
BstSLI GKGCMC 1 cut(s) 453
BtgZI GCGATG 2 cut(s) 51, 206
BveI ACCTGC 1 cut(s) 301
Cac8I GCNNGC 1 cut(s) 433
Cfr13I GGNCC 1 cut(s) 313
CviAII CATG 4 cut(s) 28, 88, 337, 490
CviJI RGCY 4 cut(s) 62, 147, 431, 435
CviKI_1 RGCY 4 cut(s) 62, 147, 431, 435
DdeI CTNAG 1 cut(s) 436
DraIII CACNNNGTG 1 cut(s) 329
Eco47I GGWCC 1 cut(s) 313
EcoO109I RGGNCCY 1 cut(s) 313
FaeI CATG 4 cut(s) 31, 91, 340, 493
FaqI GGGAC 1 cut(s) 299
FatI CATG 4 cut(s) 27, 87, 336, 489
FauNDI CATATG 1 cut(s) 478
FspBI CTAG 1 cut(s) 9
Hin1II CATG 4 cut(s) 31, 91, 340, 493
HinfI GANTC 5 cut(s) 221, 269, 353, 386, 482
HphI GGTGA 2 cut(s) 315, 416
Hpy188I TCNGA 4 cut(s) 226, 239, 268, 439
Hpy188III TCNNGA 3 cut(s) 110, 161, 390
HpyAV CCTTC 2 cut(s) 73, 245
HpyCH4III ACNGT 3 cut(s) 21, 77, 206
HpyCH4V TGCA 1 cut(s) 476
HpyF10VI GCNNNNNNNGC 1 cut(s) 33
HpyF3I CTNAG 1 cut(s) 436
Hsp92II CATG 4 cut(s) 31, 91, 340, 493
LmnI GCTCC 2 cut(s) 307, 428
LpnPI CCDG 7 cut(s) 83, 146, 190, 296, 375, 417, 452
MaeI CTAG 1 cut(s) 9
MaeIII GTNAC 1 cut(s) 122
MboII GAAGA 5 cut(s) 113, 125, 128, 260, 452
MhlI GDGCHC 1 cut(s) 453
MluCI AATT 3 cut(s) 104, 227, 340
MlyI GAGTC 2 cut(s) 215, 380
MnlI CCTC 1 cut(s) 124
MroXI GAANNNNTTC 1 cut(s) 105
MseI TTAA 1 cut(s) 23
MslI CAYNNNNRTG 1 cut(s) 86
MwoI GCNNNNNNNGC 1 cut(s) 33
NdeI CATATG 1 cut(s) 478
NlaIII CATG 4 cut(s) 31, 91, 340, 493
NlaIV GGNNCC 2 cut(s) 79, 315
NmuCI GTSAC 1 cut(s) 122
NspV TTCGAA 1 cut(s) 246
PdmI GAANNNNTTC 1 cut(s) 105
PfeI GAWTC 3 cut(s) 269, 353, 482
PflMI CCANNNNNTGG 1 cut(s) 160
PleI GAGTC 2 cut(s) 215, 380
PpsI GAGTC 2 cut(s) 215, 380
PpuMI RGGWCCY 1 cut(s) 313
Psp5II RGGWCCY 1 cut(s) 313
PspN4I GGNNCC 2 cut(s) 79, 315
PspPI GGNCC 1 cut(s) 313
PspPPI RGGWCCY 1 cut(s) 313
RseI CAYNNNNRTG 1 cut(s) 86
SaqAI TTAA 1 cut(s) 23
Sau96I GGNCC 1 cut(s) 313
SchI GAGTC 2 cut(s) 215, 380
SduI GDGCHC 1 cut(s) 453
SetI ASST 2 cut(s) 315, 433
SfuI TTCGAA 1 cut(s) 246
SinI GGWCC 1 cut(s) 313
SmiMI CAYNNNNRTG 1 cut(s) 86
Sse9I AATT 3 cut(s) 104, 227, 340
SsiI CCGC 1 cut(s) 15
SspMI CTAG 1 cut(s) 9
TaaI ACNGT 3 cut(s) 21, 77, 206
TaqI TCGA 2 cut(s) 219, 246
TasI AATT 3 cut(s) 104, 227, 340
TfiI GAWTC 3 cut(s) 269, 353, 482
Tru1I TTAA 1 cut(s) 23
Tru9I TTAA 1 cut(s) 23
TseFI GTSAC 1 cut(s) 122
Tsp45I GTSAC 1 cut(s) 122
TspDTI ATGAA 2 cut(s) 261, 353
Van91I CCANNNNNTGG 1 cut(s) 160
VpaK11BI GGWCC 1 cut(s) 313
XapI RAATTY 1 cut(s) 104
XmnI GAANNNNTTC 1 cut(s) 105
XspI CTAG 1 cut(s) 9
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.