Prupe.5G112500_v2.0.a1

BEST Arabidopsis thaliana protein match is myosin heavy

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp05
Physical Location & Seq
Reverse (-)
11629836 .. 11632206
2371 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.5G112500.1

Sequence Viewer

Length: 204 bp
ATGAGACTCTTAATTCATCTAATTCCATTCCTCTCCCTGTTTCCCGCTTTATTCTCTTCTCTCTTGGCTCTCTCCCTAACGACATGTTCACCTCACCACACCAACGACAACTACGACAATTCCTCCCTCTGCCAACTCCACCTTATTCTCTTCTCTCTTCGCATTGACTGCATGGCACAGAAGAAAAAATTCAAAATTTGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

68

Amino Acids

7.68

Weight (kDa)

8.86

Isoelectric Point (pI)

39.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 45
AcsI RAATTY 2 cut(s) 188, 195
AflIII ACRYGT 1 cut(s) 83
AgsI TTSAA 1 cut(s) 193
ApoI RAATTY 2 cut(s) 188, 195
Asp700I GAANNNNTTC 1 cut(s) 188
AsuHPI GGTGA 2 cut(s) 81, 86
BsaXI ACNNNNNCTCC 2 cut(s) 107, 137
BspACI CCGC 1 cut(s) 45
Bst6I CTCTTC 3 cut(s) 61, 155, 162
BstAPI GCANNNNNTGC 1 cut(s) 168
BstMWI GCNNNNNNNGC 1 cut(s) 168
BstNSI RCATGY 1 cut(s) 87
CviAII CATG 2 cut(s) 84, 172
CviJI RGCY 1 cut(s) 68
CviKI_1 RGCY 1 cut(s) 68
Eam1104I CTCTTC 3 cut(s) 61, 155, 162
EarI CTCTTC 3 cut(s) 61, 155, 162
FaeI CATG 2 cut(s) 87, 175
FaiI YATR 2 cut(s) 85, 173
FatI CATG 2 cut(s) 83, 171
FauI CCCGC 1 cut(s) 52
Hin1II CATG 2 cut(s) 87, 175
HinfI GANTC 1 cut(s) 6
HphI GGTGA 2 cut(s) 81, 86
Hpy166II GTNNAC 1 cut(s) 89
Hpy8I GTNNAC 1 cut(s) 89
HpyCH4V TGCA 1 cut(s) 171
HpyF10VI GCNNNNNNNGC 1 cut(s) 168
Hsp92II CATG 2 cut(s) 87, 175
LpnPI CCDG 1 cut(s) 50
MboII GAAGA 4 cut(s) 48, 142, 149, 193
MluCI AATT 5 cut(s) 12, 21, 118, 188, 195
MnlI CCTC 4 cut(s) 41, 102, 133, 137
MroXI GAANNNNTTC 1 cut(s) 188
MseI TTAA 1 cut(s) 11
MwoI GCNNNNNNNGC 1 cut(s) 168
NlaIII CATG 2 cut(s) 87, 175
NspI RCATGY 1 cut(s) 87
PciI ACATGT 1 cut(s) 83
PcsI WCGNNNNNNNCGW 1 cut(s) 111
PdmI GAANNNNTTC 1 cut(s) 188
PscI ACATGT 1 cut(s) 83
SaqAI TTAA 1 cut(s) 11
SetI ASST 2 cut(s) 94, 144
SgeI CNNG 5 cut(s) 49, 56, 76, 96, 184
Sse9I AATT 5 cut(s) 12, 21, 118, 188, 195
SsiI CCGC 1 cut(s) 45
TasI AATT 5 cut(s) 12, 21, 118, 188, 195
Tru1I TTAA 1 cut(s) 11
Tru9I TTAA 1 cut(s) 11
TspDTI ATGAA 1 cut(s) 5
XapI RAATTY 2 cut(s) 188, 195
XceI RCATGY 1 cut(s) 87
XmnI GAANNNNTTC 1 cut(s) 188
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.