pycom01g05880

snRNA processing

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr1
Physical Location & Seq
Reverse (-)
5802847 .. 5803094
248 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom01g05880.2

Sequence Viewer

Length: 198 bp
ATGGGAATGATTTCCCCTGCATCGAGTGATATTATCAATCAAAATAGCCTTTTGGATTATTTGTCTCATGGGGAGCCACCTTTATTTGAAAATAATGGTTCAACCTGTACTAGTAACAAGATGTTTGGTTCTGATGAAACCTCTGAAACTCTGTCTCCAATAGTAAAGGAGCCAGGGAAGTATGAGCTTCACTTTTAG

Protein Analysis

66

Amino Acids

7.11

Weight (kDa)

4.43

Isoelectric Point (pI)

42.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 109
AgsI TTSAA 2 cut(s) 89, 102
AhlI ACTAGT 1 cut(s) 110
AjnI CCWGG 1 cut(s) 172
AluBI AGCT 1 cut(s) 187
AluI AGCT 1 cut(s) 187
Alw26I GTCTC 2 cut(s) 69, 159
Asp700I GAANNNNTTC 1 cut(s) 10
BciT130I CCWGG 1 cut(s) 174
BcoDI GTCTC 2 cut(s) 69, 159
BcuI ACTAGT 1 cut(s) 110
BfaI CTAG 1 cut(s) 111
Bme1390I CCNGG 1 cut(s) 174
BmiI GGNNCC 2 cut(s) 75, 171
BmrFI CCNGG 1 cut(s) 174
BmsI GCATC 1 cut(s) 29
BsaJI CCNNGG 1 cut(s) 173
BsaXI ACNNNNNCTCC 2 cut(s) 139, 169
BseBI CCWGG 1 cut(s) 174
BseDI CCNNGG 1 cut(s) 173
BsmAI GTCTC 2 cut(s) 69, 159
BspLI GGNNCC 2 cut(s) 75, 171
BssECI CCNNGG 1 cut(s) 173
Bst2UI CCWGG 1 cut(s) 174
BstMAI GTCTC 2 cut(s) 69, 159
BstNI CCWGG 1 cut(s) 174
BstSCI CCNGG 1 cut(s) 172
Csp6I GTAC 1 cut(s) 108
CviAII CATG 1 cut(s) 68
CviJI RGCY 4 cut(s) 48, 76, 172, 187
CviKI_1 RGCY 4 cut(s) 48, 76, 172, 187
CviQI GTAC 1 cut(s) 108
EcoRII CCWGG 1 cut(s) 172
FaeI CATG 1 cut(s) 71
FaiI YATR 2 cut(s) 69, 183
FatI CATG 1 cut(s) 67
FspBI CTAG 1 cut(s) 111
Hin1II CATG 1 cut(s) 71
Hpy188I TCNGA 2 cut(s) 133, 145
HpyCH4V TGCA 1 cut(s) 20
Hsp92II CATG 1 cut(s) 71
LmnI GCTCC 2 cut(s) 73, 169
LpnPI CCDG 4 cut(s) 30, 118, 159, 186
LweI GCATC 1 cut(s) 29
MaeI CTAG 1 cut(s) 111
MaeIII GTNAC 1 cut(s) 113
MnlI CCTC 1 cut(s) 151
MroXI GAANNNNTTC 1 cut(s) 10
MspR9I CCNGG 1 cut(s) 174
MvaI CCWGG 1 cut(s) 174
NlaIII CATG 1 cut(s) 71
NlaIV GGNNCC 2 cut(s) 75, 171
PdmI GAANNNNTTC 1 cut(s) 10
Psp6I CCWGG 1 cut(s) 172
PspGI CCWGG 1 cut(s) 172
PspN4I GGNNCC 2 cut(s) 75, 171
RsaI GTAC 1 cut(s) 109
RsaNI GTAC 1 cut(s) 108
ScrFI CCNGG 1 cut(s) 174
SetI ASST 4 cut(s) 82, 107, 143, 189
SfaNI GCATC 1 cut(s) 29
SgeI CNNG 8 cut(s) 29, 36, 80, 117, 123, 130, 185, 186
SpeI ACTAGT 1 cut(s) 110
SspMI CTAG 1 cut(s) 111
StyD4I CCNGG 1 cut(s) 172
TaqI TCGA 1 cut(s) 23
TatI WGTACW 1 cut(s) 107
TspDTI ATGAA 1 cut(s) 150
XmnI GAANNNNTTC 1 cut(s) 10
XspI CTAG 1 cut(s) 111
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.