Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0032177.1

Orthogroup ID

OG0004412

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 330

Gene Structure 330 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0032177.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 277 bp

attatggctcaaaatgactgccaatggacttgatgatactcagtttgtctccttggattcaaacctttttggaggctgcgatgatcatagaatagttgtgtttaccgcaccattttacaaaaccccgaaagcattttcttttacagtcagcgtttgcatttgtatggaatatttgtctgaggatgaggatgtgtcttttctcaaacgttgtggacctagacatgagcttgcatctctttgccgagaaaaggaagtttttctttctatggtcaagtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003002 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005737 GO:0005768 GO:0006139 GO:0006396 GO:0006725 GO:0006807 GO:0006810 GO:0007275 GO:0007389 GO:0008150 GO:0008152 GO:0009956 GO:0009987 GO:0010467 GO:0010496 GO:0012505 GO:0016070 GO:0016073 GO:0016180 GO:0022622 GO:0031123 GO:0031410 GO:0031982 GO:0032501 GO:0032502 GO:0034470 GO:0034472 GO:0034641 GO:0034660 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043628 GO:0044237 GO:0044238 GO:0044424 GO:0044444 GO:0044464 GO:0046483 GO:0048364 GO:0048731 GO:0048856 GO:0051179 GO:0051234 GO:0071704 GO:0090057 GO:0090304 GO:0097708 GO:0099402 GO:1901360

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

91

Amino Acids

10.38

Weight (kDa)

5.23

Isoelectric Point (pI)

37.25

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004412)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G08800 AT3G08800 AT3G08800
fragaria_vesca	FvH4_6g10600 FvH4_6g10600 FvH4_6g10600 FvH4_6g10600 FvH4_6g10600
malus_domestica	MD04G1166800.v1.1
prunus_persica	Prupe.6G285000_v2.0.a1 Prupe.6G285000_v2.0.a1
pyrus_communis	pycom01g05880 pycom04g14820
rosa_chinensis	RchiOBHm_Chr3g0461591 RchiOBHm_Chr3g0461601
rosa_laevigata	RLG00000024915
rosa_multiflora	Rmu_co8098260.1_g000001 Rmu_sc0003578.1_g000001 Rmu_sc0032177.1_g000001 Rmu_sc0040016.1_g000001 Rmu_ssc0000193.1_g000007
rosa_roxburghii	Rroxscaffold_6G00418110 Rroxscaffold_6G00418480
rosa_rugosa	Rorug03G0052200 Rorug03G0052200 Rorug03G0052300 Rorug03G0052300
rosa_samantha	Rh3AG110400 Rh3BG113600 Rh3CG115500 Rh3DG115300
rosa_wichuraiana	Rw3G009340

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	106
AclI	AACGTT	1 cut(s)	206
AfiI	CCNNNNNNNGG	1 cut(s)	248
AgsI	TTSAA	1 cut(s)	61
AluBI	AGCT	1 cut(s)	227
AluI	AGCT	1 cut(s)	227
Alw26I	GTCTC	1 cut(s)	53
ApeKI	GCWGC	1 cut(s)	76
Asp700I	GAANNNNTTC	1 cut(s)	256
AspS9I	GGNCC	1 cut(s)	213
AvaII	GGWCC	1 cut(s)	213
BbvI	GCAGC	1 cut(s)	63
BclI	TGATCA	1 cut(s)	83
BcoDI	GTCTC	1 cut(s)	53
BfaI	CTAG	1 cut(s)	217
BisI	GCNGC	1 cut(s)	77
BlsI	GCNGC	1 cut(s)	78
Bme18I	GGWCC	1 cut(s)	213
BmgT120I	GGNCC	1 cut(s)	213
BmsI	GCATC	1 cut(s)	240
BsaJI	CCNNGG	1 cut(s)	52
Bsc4I	CCNNNNNNNGG	1 cut(s)	248
BseDI	CCNNGG	1 cut(s)	52
BseGI	GGATG	2 cut(s)	188, 194
BseLI	CCNNNNNNNGG	1 cut(s)	248
BseMII	CTCAG	2 cut(s)	54, 169
BseXI	GCAGC	1 cut(s)	63
BslI	CCNNNNNNNGG	1 cut(s)	248
BsmAI	GTCTC	1 cut(s)	53
Bsp143I	GATC	1 cut(s)	83
BspACI	CCGC	1 cut(s)	106
BspCNI	CTCAG	2 cut(s)	53, 170
BssECI	CCNNGG	1 cut(s)	52
BssMI	GATC	1 cut(s)	83
BssT1I	CCWWGG	1 cut(s)	52
Bst4CI	ACNGT	1 cut(s)	146
BstC8I	GCNNGC	1 cut(s)	229
BstDEI	CTNAG	2 cut(s)	40, 178
BstF5I	GGATG	2 cut(s)	188, 194
BstKTI	GATC	1 cut(s)	86
BstMAI	GTCTC	1 cut(s)	53
BstMBI	GATC	1 cut(s)	83
BstV1I	GCAGC	1 cut(s)	63
BtgZI	GCGATG	1 cut(s)	94
BtsCI	GGATG	2 cut(s)	188, 194
Cac8I	GCNNGC	1 cut(s)	229
Cfr13I	GGNCC	1 cut(s)	213
CspCI	CAANNNNNGTGG	2 cut(s)	191, 226
CviAII	CATG	1 cut(s)	222
CviJI	RGCY	3 cut(s)	8, 76, 227
CviKI_1	RGCY	3 cut(s)	8, 76, 227
DdeI	CTNAG	2 cut(s)	40, 178
DpnI	GATC	1 cut(s)	85
DpnII	GATC	1 cut(s)	83
Eco130I	CCWWGG	1 cut(s)	52
Eco47I	GGWCC	1 cut(s)	213
EcoT14I	CCWWGG	1 cut(s)	52
ErhI	CCWWGG	1 cut(s)	52
FaeI	CATG	1 cut(s)	225
FaiI	YATR	5 cut(s)	5, 88, 165, 223, 267
FalI	AAGNNNNNCTT	2 cut(s)	244, 276
FatI	CATG	1 cut(s)	221
FbaI	TGATCA	1 cut(s)	83
Fnu4HI	GCNGC	1 cut(s)	77
FokI	GGATG	2 cut(s)	195, 201
Fsp4HI	GCNGC	1 cut(s)	77
FspBI	CTAG	1 cut(s)	217
GluI	GCNGC	1 cut(s)	77
Hin1II	CATG	1 cut(s)	225
HinfI	GANTC	1 cut(s)	57
Hpy166II	GTNNAC	2 cut(s)	103, 213
Hpy188I	TCNGA	1 cut(s)	179
Hpy8I	GTNNAC	2 cut(s)	103, 213
HpyCH4III	ACNGT	1 cut(s)	146
HpyCH4IV	ACGT	1 cut(s)	206
HpyCH4V	TGCA	2 cut(s)	157, 231
HpyF3I	CTNAG	2 cut(s)	40, 178
HpySE526I	ACGT	1 cut(s)	206
Hsp92II	CATG	1 cut(s)	225
Ksp22I	TGATCA	1 cut(s)	83
Kzo9I	GATC	1 cut(s)	83
Lsp1109I	GCAGC	1 cut(s)	63
LweI	GCATC	1 cut(s)	240
MaeI	CTAG	1 cut(s)	217
MaeII	ACGT	1 cut(s)	206
MalI	GATC	1 cut(s)	85
MboI	GATC	1 cut(s)	83
MnlI	CCTC	3 cut(s)	66, 173, 179
MroXI	GAANNNNTTC	1 cut(s)	256
MslI	CAYNNNNRTG	1 cut(s)	162
NdeII	GATC	1 cut(s)	83
NlaIII	CATG	1 cut(s)	225
NmeAIII	GCCGAG	1 cut(s)	267
PdmI	GAANNNNTTC	1 cut(s)	256
PfeI	GAWTC	1 cut(s)	57
PkrI	GCNGC	1 cut(s)	78
Psp1406I	AACGTT	1 cut(s)	206
PspPI	GGNCC	1 cut(s)	213
RseI	CAYNNNNRTG	1 cut(s)	162
SatI	GCNGC	1 cut(s)	77
Sau3AI	GATC	1 cut(s)	83
Sau96I	GGNCC	1 cut(s)	213
SetI	ASST	4 cut(s)	67, 209, 218, 229
SfaNI	GCATC	1 cut(s)	240
SgeI	CNNG	7 cut(s)	42, 65, 137, 229, 234, 240, 255
SinI	GGWCC	1 cut(s)	213
SmiMI	CAYNNNNRTG	1 cut(s)	162
SsiI	CCGC	1 cut(s)	106
SspI	AATATT	1 cut(s)	171
SspMI	CTAG	1 cut(s)	217
StyI	CCWWGG	1 cut(s)	52
TaaI	ACNGT	1 cut(s)	146
TaiI	ACGT	1 cut(s)	209
TfiI	GAWTC	1 cut(s)	57
TseI	GCWGC	1 cut(s)	76
VpaK11BI	GGWCC	1 cut(s)	213
XmnI	GAANNNNTTC	1 cut(s)	256
XspI	CTAG	1 cut(s)	217

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.