pycom01g23770

Heavy-metal-associated domain

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr1
Physical Location & Seq
Reverse (-)
20991714 .. 20992499
786 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom01g23770.2

Sequence Viewer

Length: 330 bp
ATGGCCGATATGCAAATTGTTCCTGCCTGCAAAAACGTAGAAGCGCAGTATGTGGAGATGATGGTTCCTCTCTATTCTCATGGATGTGAGAAGAAAATAAAGAAGACCCTCTCCTATCTCAAAGGGATATACTCAGTGAAGGTGGATTATAACGAACAAAAGGTGACGGTATGGGGAATATGCAACAAATACGATGTGCTTGCAACCGTAAGGAGCAAGAGAAAACACGCATGTTTTTGGAACCCTAAAGACAACATCGCCTTAGAATCAATCACCAGAACCACCAGCGGTGACAACACCACCACCTTCCTCTCCTTCTCCTATTCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

110

Amino Acids

12.47

Weight (kDa)

9.05

Isoelectric Point (pI)

30.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 150
AciI CCGC 1 cut(s) 288
AcoI YGGCCR 1 cut(s) 3
AoxI GGCC 1 cut(s) 3
AspLEI GCGC 1 cut(s) 46
AsuHPI GGTGA 3 cut(s) 175, 265, 302
BbsI GAAGAC 1 cut(s) 110
BccI CCATC 1 cut(s) 55
BcgI CGANNNNNNTGC 2 cut(s) 182, 216
BmiI GGNNCC 2 cut(s) 66, 242
BpiI GAAGAC 1 cut(s) 110
BseGI GGATG 1 cut(s) 89
BseMII CTCAG 1 cut(s) 147
BshFI GGCC 1 cut(s) 5
BsnI GGCC 1 cut(s) 5
BspACI CCGC 1 cut(s) 288
BspANI GGCC 1 cut(s) 5
BspCNI CTCAG 1 cut(s) 146
BspLI GGNNCC 2 cut(s) 66, 242
Bst4CI ACNGT 2 cut(s) 169, 208
BstC8I GCNNGC 2 cut(s) 28, 201
BstDEI CTNAG 2 cut(s) 133, 262
BstF5I GGATG 1 cut(s) 89
BstHHI GCGC 1 cut(s) 46
BstNSI RCATGY 1 cut(s) 234
BstV2I GAAGAC 1 cut(s) 110
BsuRI GGCC 1 cut(s) 5
BtgZI GCGATG 1 cut(s) 241
BtsCI GGATG 1 cut(s) 89
BtsIMutI CAGTG 1 cut(s) 141
Cac8I GCNNGC 2 cut(s) 28, 201
CfoI GCGC 1 cut(s) 46
CviAII CATG 2 cut(s) 80, 231
CviJI RGCY 1 cut(s) 5
CviKI_1 RGCY 1 cut(s) 5
DdeI CTNAG 2 cut(s) 133, 262
EaeI YGGCCR 1 cut(s) 3
FaeI CATG 2 cut(s) 83, 234
FaiI YATR 9 cut(s) 11, 51, 81, 130, 150, 172, 181, 232, 328
FatI CATG 2 cut(s) 79, 230
FokI GGATG 1 cut(s) 96
GlaI GCGC 1 cut(s) 45
HaeIII GGCC 1 cut(s) 5
HhaI GCGC 1 cut(s) 46
Hin1II CATG 2 cut(s) 83, 234
Hin6I GCGC 1 cut(s) 44
HinP1I GCGC 1 cut(s) 44
HinfI GANTC 1 cut(s) 266
HphI GGTGA 3 cut(s) 175, 265, 302
HpyAV CCTTC 3 cut(s) 133, 316, 325
HpyCH4III ACNGT 2 cut(s) 169, 208
HpyCH4IV ACGT 1 cut(s) 36
HpyCH4V TGCA 4 cut(s) 13, 30, 183, 203
HpyF3I CTNAG 2 cut(s) 133, 262
HpySE526I ACGT 1 cut(s) 36
Hsp92II CATG 2 cut(s) 83, 234
HspAI GCGC 1 cut(s) 44
LmnI GCTCC 1 cut(s) 213
LpnPI CCDG 4 cut(s) 36, 40, 289, 298
MaeII ACGT 1 cut(s) 36
MaeIII GTNAC 2 cut(s) 163, 290
MboII GAAGA 2 cut(s) 103, 115
MluCI AATT 1 cut(s) 15
MnlI CCTC 3 cut(s) 78, 119, 320
MslI CAYNNNNRTG 1 cut(s) 84
MspA1I CMGCKG 1 cut(s) 288
NlaIII CATG 2 cut(s) 83, 234
NlaIV GGNNCC 2 cut(s) 66, 242
NmuCI GTSAC 2 cut(s) 163, 290
NspI RCATGY 1 cut(s) 234
PfeI GAWTC 1 cut(s) 266
PsiI TTATAA 1 cut(s) 150
PspN4I GGNNCC 2 cut(s) 66, 242
RseI CAYNNNNRTG 1 cut(s) 84
SetI ASST 4 cut(s) 39, 144, 165, 308
SgeI CNNG 9 cut(s) 35, 39, 92, 212, 229, 239, 243, 288, 297
SmiMI CAYNNNNRTG 1 cut(s) 84
Sse9I AATT 1 cut(s) 15
SsiI CCGC 1 cut(s) 288
TaaI ACNGT 2 cut(s) 169, 208
TaiI ACGT 1 cut(s) 39
TasI AATT 1 cut(s) 15
TfiI GAWTC 1 cut(s) 266
TscAI CASTG 1 cut(s) 141
TseFI GTSAC 2 cut(s) 163, 290
Tsp45I GTSAC 2 cut(s) 163, 290
TspDTI ATGAA 1 cut(s) 315
TspRI CASTG 1 cut(s) 141
XceI RCATGY 1 cut(s) 234
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.