Rh1DG111000

Heavy-metal-associated domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
OG0006800
Physical Location & Seq
Forward (+)
20434037 .. 20434698
662 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG111000.1

Sequence Viewer

Length: 258 bp
ATGGCTGATATGCAAATCGTTCTGGCTTTAAAAACTAGTGTGGAAGCGCAGTATGAGGAAATTATGGTTCCTCTTTATTCTCCTGGGTTCGAGAAGAAAGTCAAGAAGGCCCTATCCCACCTCAAAGGAATATACTCGGTGAACGTAGACTGCAGCCAACAAAAGGTGACGGTTTGGGGAATATGCAACAAATACGATGTGCTAGCCACAAATCACAATAAGGACCAAGAGAAAACACGCTTGCTTTTGGAATCCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
HMA

Protein Analysis

85

Amino Acids

9.66

Weight (kDa)

7.75

Isoelectric Point (pI)

27.33

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
HMA PF00403 27 - 60 3.6e-06 Heavy-metal-associated domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 147
AfiI CCNNNNNNNGG 1 cut(s) 163
AhlI ACTAGT 1 cut(s) 35
AjnI CCWGG 1 cut(s) 82
AoxI GGCC 1 cut(s) 108
ApeKI GCWGC 1 cut(s) 153
AspLEI GCGC 1 cut(s) 49
AspS9I GGNCC 2 cut(s) 109, 223
AsuHPI GGTGA 2 cut(s) 151, 178
AsuNHI GCTAGC 1 cut(s) 202
AvaII GGWCC 1 cut(s) 223
BbvI GCAGC 1 cut(s) 165
BciT130I CCWGG 1 cut(s) 84
BcuI ACTAGT 1 cut(s) 35
BfaI CTAG 2 cut(s) 36, 203
BfmI CTRYAG 1 cut(s) 151
BisI GCNGC 1 cut(s) 154
BlsI GCNGC 1 cut(s) 155
Bme1390I CCNGG 1 cut(s) 84
Bme18I GGWCC 1 cut(s) 223
BmgT120I GGNCC 2 cut(s) 109, 223
BmiI GGNNCC 1 cut(s) 69
BmrFI CCNGG 1 cut(s) 84
BmtI GCTAGC 1 cut(s) 206
BsaJI CCNNGG 1 cut(s) 83
Bsc4I CCNNNNNNNGG 1 cut(s) 163
BseBI CCWGG 1 cut(s) 84
BseDI CCNNGG 1 cut(s) 83
BseLI CCNNNNNNNGG 1 cut(s) 163
BseXI GCAGC 1 cut(s) 165
BshFI GGCC 1 cut(s) 110
BslI CCNNNNNNNGG 1 cut(s) 163
BsnI GGCC 1 cut(s) 110
BspANI GGCC 1 cut(s) 110
BspLI GGNNCC 1 cut(s) 69
BspMAI CTGCAG 1 cut(s) 155
BspOI GCTAGC 1 cut(s) 206
BssECI CCNNGG 1 cut(s) 83
Bst2UI CCWGG 1 cut(s) 84
Bst4CI ACNGT 1 cut(s) 172
BstC8I GCNNGC 2 cut(s) 204, 242
BstHHI GCGC 1 cut(s) 49
BstNI CCWGG 1 cut(s) 84
BstSCI CCNGG 1 cut(s) 82
BstSFI CTRYAG 1 cut(s) 151
BstV1I GCAGC 1 cut(s) 165
BsuRI GGCC 1 cut(s) 110
Cac8I GCNNGC 2 cut(s) 204, 242
CfoI GCGC 1 cut(s) 49
Cfr13I GGNCC 2 cut(s) 109, 223
CviJI RGCY 5 cut(s) 5, 26, 110, 156, 206
CviKI_1 RGCY 5 cut(s) 5, 26, 110, 156, 206
DraI TTTAAA 1 cut(s) 30
Eco47I GGWCC 1 cut(s) 223
EcoO109I RGGNCCY 1 cut(s) 109
EcoRII CCWGG 1 cut(s) 82
FaiI YATR 5 cut(s) 11, 54, 65, 133, 184
FblI GTMKAC 1 cut(s) 147
Fnu4HI GCNGC 1 cut(s) 154
Fsp4HI GCNGC 1 cut(s) 154
FspBI CTAG 2 cut(s) 36, 203
GlaI GCGC 1 cut(s) 48
GluI GCNGC 1 cut(s) 154
HaeIII GGCC 1 cut(s) 110
HhaI GCGC 1 cut(s) 49
Hin6I GCGC 1 cut(s) 47
HinP1I GCGC 1 cut(s) 47
HinfI GANTC 1 cut(s) 251
HphI GGTGA 2 cut(s) 151, 178
Hpy166II GTNNAC 2 cut(s) 142, 148
Hpy188III TCNNGA 3 cut(s) 91, 103, 255
Hpy8I GTNNAC 2 cut(s) 142, 148
HpyAV CCTTC 1 cut(s) 100
HpyCH4III ACNGT 1 cut(s) 172
HpyCH4IV ACGT 1 cut(s) 144
HpyCH4V TGCA 3 cut(s) 13, 153, 186
HpySE526I ACGT 1 cut(s) 144
HspAI GCGC 1 cut(s) 47
LpnPI CCDG 3 cut(s) 8, 69, 96
Lsp1109I GCAGC 1 cut(s) 165
MaeI CTAG 2 cut(s) 36, 203
MaeII ACGT 1 cut(s) 144
MaeIII GTNAC 1 cut(s) 166
MboII GAAGA 1 cut(s) 106
MluCI AATT 1 cut(s) 60
MnlI CCTC 3 cut(s) 49, 81, 131
MseI TTAA 1 cut(s) 29
MspR9I CCNGG 1 cut(s) 84
MvaI CCWGG 1 cut(s) 84
NheI GCTAGC 1 cut(s) 202
NlaIV GGNNCC 1 cut(s) 69
NmuCI GTSAC 1 cut(s) 166
PfeI GAWTC 1 cut(s) 251
PkrI GCNGC 1 cut(s) 155
Psp6I CCWGG 1 cut(s) 82
PspGI CCWGG 1 cut(s) 82
PspN4I GGNNCC 1 cut(s) 69
PspPI GGNCC 2 cut(s) 109, 223
PstI CTGCAG 1 cut(s) 155
SaqAI TTAA 1 cut(s) 29
SatI GCNGC 1 cut(s) 154
Sau96I GGNCC 2 cut(s) 109, 223
ScrFI CCNGG 1 cut(s) 84
SetI ASST 3 cut(s) 123, 147, 168
SfcI CTRYAG 1 cut(s) 151
SinI GGWCC 1 cut(s) 223
SpeI ACTAGT 1 cut(s) 35
Sse9I AATT 1 cut(s) 60
SspMI CTAG 2 cut(s) 36, 203
StyD4I CCNGG 1 cut(s) 82
TaaI ACNGT 1 cut(s) 172
TaiI ACGT 1 cut(s) 147
TaqI TCGA 1 cut(s) 90
TasI AATT 1 cut(s) 60
TfiI GAWTC 1 cut(s) 251
Tru1I TTAA 1 cut(s) 29
Tru9I TTAA 1 cut(s) 29
TseFI GTSAC 1 cut(s) 166
TseI GCWGC 1 cut(s) 153
Tsp45I GTSAC 1 cut(s) 166
VpaK11BI GGWCC 1 cut(s) 223
XmiI GTMKAC 1 cut(s) 147
XspI CTAG 2 cut(s) 36, 203
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.