pycom02g16110

TVP38 TMEM64 family membrane protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr2
Physical Location & Seq
Reverse (-)
13155640 .. 13156337
698 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom02g16110.2

Sequence Viewer

Length: 183 bp
ATGGTTCAGCTCGGTGGTGGTTATCTTTTTGGGCTACCTGTTGGCTTTGTTGCTGATTCAATTGGAGCCACTTTAGGTGCAGGGGCTGCTCTCCTTCTCGGAAGAACTGCTACAGCTGATGATCAGATCCAAGTTATTGAGATGATTAAGCTCTTGGAAACAAAGGGTTGGAAGACTTTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

61

Amino Acids

6.23

Weight (kDa)

4.86

Isoelectric Point (pI)

19.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 121
AgsI TTSAA 1 cut(s) 60
AluBI AGCT 3 cut(s) 10, 116, 151
AluI AGCT 3 cut(s) 10, 116, 151
AlwI GGATC 1 cut(s) 121
AlwNI CAGNNNCTG 1 cut(s) 86
ApeKI GCWGC 1 cut(s) 86
BarI GAAGNNNNNNTAC 2 cut(s) 94, 126
BbsI GAAGAC 1 cut(s) 179
BbvI GCAGC 1 cut(s) 73
BclI TGATCA 1 cut(s) 121
BfmI CTRYAG 1 cut(s) 111
BisI GCNGC 1 cut(s) 87
BlsI GCNGC 1 cut(s) 88
BmiI GGNNCC 1 cut(s) 67
BpiI GAAGAC 1 cut(s) 179
BseXI GCAGC 1 cut(s) 73
BsgI GTGCAG 1 cut(s) 99
Bsp143I GATC 2 cut(s) 121, 126
BspLI GGNNCC 1 cut(s) 67
BspPI GGATC 1 cut(s) 121
BssMI GATC 2 cut(s) 121, 126
BstAPI GCANNNNNTGC 1 cut(s) 86
BstKTI GATC 2 cut(s) 124, 129
BstMBI GATC 2 cut(s) 121, 126
BstMWI GCNNNNNNNGC 1 cut(s) 86
BstSFI CTRYAG 1 cut(s) 111
BstV1I GCAGC 1 cut(s) 73
BstV2I GAAGAC 1 cut(s) 179
BstX2I RGATCY 1 cut(s) 126
BstYI RGATCY 1 cut(s) 126
CaiI CAGNNNCTG 1 cut(s) 86
CviJI RGCY 7 cut(s) 10, 34, 45, 68, 86, 116, 151
CviKI_1 RGCY 7 cut(s) 10, 34, 45, 68, 86, 116, 151
DpnI GATC 2 cut(s) 123, 128
DpnII GATC 2 cut(s) 121, 126
FbaI TGATCA 1 cut(s) 121
Fnu4HI GCNGC 1 cut(s) 87
Fsp4HI GCNGC 1 cut(s) 87
GluI GCNGC 1 cut(s) 87
HinfI GANTC 1 cut(s) 56
Hpy188I TCNGA 2 cut(s) 101, 126
HpyAV CCTTC 1 cut(s) 104
HpyCH4V TGCA 1 cut(s) 80
HpyF10VI GCNNNNNNNGC 1 cut(s) 86
Ksp22I TGATCA 1 cut(s) 121
Kzo9I GATC 2 cut(s) 121, 126
LmnI GCTCC 1 cut(s) 65
LpnPI CCDG 2 cut(s) 51, 66
Lsp1109I GCAGC 1 cut(s) 73
MalI GATC 2 cut(s) 123, 128
MboI GATC 2 cut(s) 121, 126
MboII GAAGA 1 cut(s) 114
MfeI CAATTG 1 cut(s) 60
MflI RGATCY 1 cut(s) 126
MluCI AATT 1 cut(s) 60
MmeI TCCRAC 1 cut(s) 149
MseI TTAA 2 cut(s) 147, 181
MspA1I CMGCKG 1 cut(s) 116
MunI CAATTG 1 cut(s) 60
MwoI GCNNNNNNNGC 1 cut(s) 86
NdeII GATC 2 cut(s) 121, 126
NlaIV GGNNCC 1 cut(s) 67
PfeI GAWTC 1 cut(s) 56
PkrI GCNGC 1 cut(s) 88
PspN4I GGNNCC 1 cut(s) 67
PstNI CAGNNNCTG 1 cut(s) 86
PsuI RGATCY 1 cut(s) 126
PvuII CAGCTG 1 cut(s) 116
SaqAI TTAA 2 cut(s) 147, 181
SatI GCNGC 1 cut(s) 87
Sau3AI GATC 2 cut(s) 121, 126
SetI ASST 5 cut(s) 12, 40, 79, 118, 153
SfcI CTRYAG 1 cut(s) 111
SgeI CNNG 6 cut(s) 23, 50, 93, 110, 143, 166
Sse9I AATT 1 cut(s) 60
TasI AATT 1 cut(s) 60
TfiI GAWTC 1 cut(s) 56
Tru1I TTAA 2 cut(s) 147, 181
Tru9I TTAA 2 cut(s) 147, 181
TseI GCWGC 1 cut(s) 86
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.