pycom03g00670

SRP40, C-terminal domain

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr3
Physical Location & Seq
Forward (+)
561245 .. 561572
328 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom03g00670.1

Sequence Viewer

Length: 273 bp
ATGAGATTGAGAAAAATTGTCCCTTTTTCCTACTGTACAATTACCTTTAAAGACAAAATTCAATTGAAACTAAAAGCAAAATTTATCTATAAACTCATGTTCAATAATCAAACACTCCGCTCTATAGCTCGATTCTTGGAGAGCAATGGATTCTCCAAACCCTTGAAAAAGTTTATTTCAAAATCAGAAATCGAGAATGGTGGACTGAAGGACAATTTACTGGATTTGAAAGAAATGTATTGCAAGTATTCCGAGATGTGTAGTGGAGACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

91

Amino Acids

10.59

Weight (kDa)

9.65

Isoelectric Point (pI)

27.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 120
AciI CCGC 1 cut(s) 118
AcsI RAATTY 2 cut(s) 57, 80
AcuI CTGAAG 1 cut(s) 227
AfaI GTAC 1 cut(s) 37
AgsI TTSAA 6 cut(s) 62, 67, 103, 166, 180, 229
AluBI AGCT 1 cut(s) 128
AluI AGCT 1 cut(s) 128
Alw26I GTCTC 1 cut(s) 261
ApoI RAATTY 2 cut(s) 57, 80
BcoDI GTCTC 1 cut(s) 261
BfmI CTRYAG 1 cut(s) 123
Bse1I ACTGG 1 cut(s) 225
Bse3DI GCAATG 1 cut(s) 151
BseMI GCAATG 1 cut(s) 151
BseNI ACTGG 1 cut(s) 225
BslFI GGGAC 1 cut(s) 5
BsmAI GTCTC 1 cut(s) 261
BsmFI GGGAC 1 cut(s) 5
Bsp1407I TGTACA 1 cut(s) 35
BspACI CCGC 1 cut(s) 118
BsrBI CCGCTC 1 cut(s) 120
BsrDI GCAATG 1 cut(s) 151
BsrGI TGTACA 1 cut(s) 35
BsrI ACTGG 1 cut(s) 225
Bst4CI ACNGT 1 cut(s) 35
BstAUI TGTACA 1 cut(s) 35
BstMAI GTCTC 1 cut(s) 261
BstSFI CTRYAG 1 cut(s) 123
Csp6I GTAC 1 cut(s) 36
CviAII CATG 1 cut(s) 97
CviJI RGCY 1 cut(s) 128
CviKI_1 RGCY 1 cut(s) 128
CviQI GTAC 1 cut(s) 36
DraI TTTAAA 1 cut(s) 49
Eco57I CTGAAG 1 cut(s) 227
FaeI CATG 1 cut(s) 100
FaiI YATR 3 cut(s) 90, 98, 125
FaqI GGGAC 1 cut(s) 5
FatI CATG 1 cut(s) 96
Hin1II CATG 1 cut(s) 100
HinfI GANTC 2 cut(s) 132, 150
Hpy166II GTNNAC 1 cut(s) 203
Hpy188I TCNGA 2 cut(s) 187, 253
Hpy188III TCNNGA 1 cut(s) 193
Hpy8I GTNNAC 1 cut(s) 203
HpyAV CCTTC 1 cut(s) 202
HpyCH4III ACNGT 1 cut(s) 35
HpyCH4V TGCA 1 cut(s) 243
Hsp92II CATG 1 cut(s) 100
LpnPI CCDG 1 cut(s) 206
MbiI CCGCTC 1 cut(s) 120
MfeI CAATTG 1 cut(s) 62
MluCI AATT 6 cut(s) 15, 39, 57, 62, 80, 214
MseI TTAA 1 cut(s) 48
MunI CAATTG 1 cut(s) 62
NlaIII CATG 1 cut(s) 100
PfeI GAWTC 2 cut(s) 132, 150
RsaI GTAC 1 cut(s) 37
RsaNI GTAC 1 cut(s) 36
SaqAI TTAA 1 cut(s) 48
SetI ASST 2 cut(s) 47, 130
SfcI CTRYAG 1 cut(s) 123
SgeI CNNG 8 cut(s) 109, 141, 148, 175, 205, 233, 256, 265
Sse9I AATT 6 cut(s) 15, 39, 57, 62, 80, 214
SsiI CCGC 1 cut(s) 118
TaaI ACNGT 1 cut(s) 35
TaqI TCGA 2 cut(s) 130, 192
TasI AATT 6 cut(s) 15, 39, 57, 62, 80, 214
TatI WGTACW 1 cut(s) 35
TfiI GAWTC 2 cut(s) 132, 150
Tru1I TTAA 1 cut(s) 48
Tru9I TTAA 1 cut(s) 48
XapI RAATTY 2 cut(s) 57, 80
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.