pycom05g20750

The proteasome is a multicatalytic proteinase complex which is characterized by its ability to cleave peptides with Arg, Phe, Tyr, Leu, and Glu adjacent to the leaving group at neutral or slightly basic pH

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr5
Physical Location & Seq
Forward (+)
23497321 .. 23498178
858 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom05g20750.4

Sequence Viewer

Length: 222 bp
ATGGGGAAAAATGTTTCTAACGCAAAAACATTTCTTGAGAAAAGGTACACCGAGGACATGGAACTTGATGATGCTGTCCACACGGCAATATTGACCCTGAAAGAAGGGTTTGAAGGACAAATTTCTGGTAAAAACATTGAGATTGGGATAATTGGCGCTGACAAAAAATTCAGAGTACTTACACCAGCTGAAATTGAAGATTACTTGGCCGAGGTGGAGTAG

Protein Analysis

74

Amino Acids

8.15

Weight (kDa)

4.7

Isoelectric Point (pI)

41.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 207
AcsI RAATTY 2 cut(s) 120, 167
AfaI GTAC 2 cut(s) 47, 177
AgsI TTSAA 2 cut(s) 113, 197
AluBI AGCT 1 cut(s) 188
AluI AGCT 1 cut(s) 188
AoxI GGCC 1 cut(s) 207
ApoI RAATTY 2 cut(s) 120, 167
AspLEI GCGC 1 cut(s) 158
BceAI ACGGC 1 cut(s) 99
BfoI RGCGCY 1 cut(s) 159
BmcAI AGTACT 1 cut(s) 177
BmsI GCATC 1 cut(s) 61
BpuEI CTTGAG 1 cut(s) 56
BsaJI CCNNGG 2 cut(s) 51, 210
BseDI CCNNGG 2 cut(s) 51, 210
BshFI GGCC 1 cut(s) 209
BsnI GGCC 1 cut(s) 209
BspANI GGCC 1 cut(s) 209
BssECI CCNNGG 2 cut(s) 51, 210
BstH2I RGCGCY 1 cut(s) 159
BstHHI GCGC 1 cut(s) 158
BsuRI GGCC 1 cut(s) 209
CfoI GCGC 1 cut(s) 158
Csp6I GTAC 2 cut(s) 46, 176
CviAII CATG 1 cut(s) 58
CviJI RGCY 2 cut(s) 188, 209
CviKI_1 RGCY 2 cut(s) 188, 209
CviQI GTAC 2 cut(s) 46, 176
EaeI YGGCCR 1 cut(s) 207
FaeI CATG 1 cut(s) 61
FaiI YATR 1 cut(s) 59
FatI CATG 1 cut(s) 57
GlaI GCGC 1 cut(s) 157
HaeII RGCGCY 1 cut(s) 159
HaeIII GGCC 1 cut(s) 209
HhaI GCGC 1 cut(s) 158
Hin1II CATG 1 cut(s) 61
Hin6I GCGC 1 cut(s) 156
HinP1I GCGC 1 cut(s) 156
Hpy166II GTNNAC 2 cut(s) 48, 79
Hpy188I TCNGA 1 cut(s) 173
Hpy188III TCNNGA 1 cut(s) 35
Hpy8I GTNNAC 2 cut(s) 48, 79
HpyAV CCTTC 2 cut(s) 98, 107
Hsp92II CATG 1 cut(s) 61
HspAI GCGC 1 cut(s) 156
LpnPI CCDG 3 cut(s) 110, 111, 198
LweI GCATC 1 cut(s) 61
MboII GAAGA 1 cut(s) 209
MluCI AATT 4 cut(s) 120, 150, 167, 192
MnlI CCTC 2 cut(s) 46, 205
MspA1I CMGCKG 1 cut(s) 188
NlaIII CATG 1 cut(s) 61
PvuII CAGCTG 1 cut(s) 188
RsaI GTAC 2 cut(s) 47, 177
RsaNI GTAC 2 cut(s) 46, 176
ScaI AGTACT 1 cut(s) 177
SetI ASST 3 cut(s) 47, 190, 216
SfaNI GCATC 1 cut(s) 61
SgeI CNNG 9 cut(s) 47, 64, 70, 77, 94, 109, 138, 197, 217
SmlI CTYRAG 1 cut(s) 35
SmoI CTYRAG 1 cut(s) 35
Sse9I AATT 4 cut(s) 120, 150, 167, 192
SspI AATATT 1 cut(s) 90
TasI AATT 4 cut(s) 120, 150, 167, 192
TatI WGTACW 1 cut(s) 175
XapI RAATTY 2 cut(s) 120, 167
ZrmI AGTACT 1 cut(s) 177
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.