Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr6

Orthogroup ID

OG0002875

Physical Location & Seq

Genomic Coordinates Reverse (-)

2814408 .. 2814686

Gene Structure 279 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom06g02350.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 279 bp

ATGCATGTGCAGCTGCTGCAAGCTAAAAATCACCATTTAGCTTCAGACAGGATCTCAACACATCCTCGTCTCCTCCAGCAGGTTTTCCTCCTCTTCATTGTCTGCAACCTGCAGCGCCTATTTCCAGCAACAACCCATCGAGCCAGACAAAATTCCCACACTTCCTCCTACCTCAGGACCTTCTCATCACCTGTGAATCCCATAGCTCCACCTGCTGCAAAACCCCTGCAACACTTGAGACTAAACATCACCAGGAGAAGTGTTGCTTTGAGTACCTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

QWRF

Protein Analysis

93

Amino Acids

10.48

Weight (kDa)

12.0

Isoelectric Point (pI)

71.66

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002875)

Species	Orthologous Gene IDs
pyrus_communis	pycom03g02900 pycom03g18040 pycom03g21830 pycom04g14340 pycom05g02500 pycom05g05350 pycom05g13410 pycom05g18620 pycom06g02350 pycom06g08160 pycom06g19050 pycom07g14020 pycom08g08130 pycom09g01870 pycom09g08440 pycom10g07570 pycom10g09370 pycom10g19140 pycom10g26070 pycom11g06270 pycom11g15940 pycom11g27190 pycom12g05510 pycom12g14550 pycom12g15280 pycom12g19100 pycom12g22220 pycom13g04640 pycom13g08110 pycom13g09300 pycom14g16880 pycom15g17640 pycom15g27350 pycom15g29140 pycom15g32610 pycom15g36040 pycom16g08180 pycom16g24920 pycom17g05460

Species

Orthologous Gene IDs

pyrus_communis

pycom03g02900 pycom03g18040 pycom03g21830 pycom04g14340 pycom05g02500 pycom05g05350 pycom05g13410 pycom05g18620 pycom06g02350 pycom06g08160 pycom06g19050 pycom07g14020 pycom08g08130 pycom09g01870 pycom09g08440 pycom10g07570 pycom10g09370 pycom10g19140 pycom10g26070 pycom11g06270 pycom11g15940 pycom11g27190 pycom12g05510 pycom12g14550 pycom12g15280 pycom12g19100 pycom12g22220 pycom13g04640 pycom13g08110 pycom13g09300 pycom14g16880 pycom15g17640 pycom15g27350 pycom15g29140 pycom15g32610 pycom15g36040 pycom16g08180 pycom16g24920 pycom17g05460

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	220
Acc36I	ACCTGC	3 cut(s)	70, 117, 220
AclWI	GGATC	1 cut(s)	59
AcsI	RAATTY	1 cut(s)	151
AcuI	CTGAAG	1 cut(s)	27
AfaI	GTAC	1 cut(s)	274
AfiI	CCNNNNNNNGG	2 cut(s)	79, 174
AjnI	CCWGG	1 cut(s)	251
AluBI	AGCT	4 cut(s)	13, 23, 41, 206
AluI	AGCT	4 cut(s)	13, 23, 41, 206
Alw26I	GTCTC	2 cut(s)	74, 232
AlwI	GGATC	1 cut(s)	59
AlwNI	CAGNNNCTG	1 cut(s)	16
ApeKI	GCWGC	5 cut(s)	10, 13, 16, 112, 215
ApoI	RAATTY	1 cut(s)	151
AspLEI	GCGC	1 cut(s)	117
AspS9I	GGNCC	1 cut(s)	177
AsuHPI	GGTGA	3 cut(s)	23, 180, 241
AvaII	GGWCC	1 cut(s)	177
AxyI	CCTNAGG	1 cut(s)	173
BbvI	GCAGC	4 cut(s)	3, 22, 124, 202
BccI	CCATC	1 cut(s)	144
BciT130I	CCWGG	1 cut(s)	253
BcoDI	GTCTC	2 cut(s)	74, 232
BfaI	CTAG	1 cut(s)	277
BfmI	CTRYAG	1 cut(s)	110
BfoI	RGCGCY	1 cut(s)	118
BfuAI	ACCTGC	3 cut(s)	70, 117, 220
BisI	GCNGC	5 cut(s)	11, 14, 17, 113, 216
BlsI	GCNGC	5 cut(s)	12, 15, 18, 114, 217
Bme1390I	CCNGG	1 cut(s)	253
Bme18I	GGWCC	1 cut(s)	177
BmgT120I	GGNCC	1 cut(s)	177
BmrFI	CCNGG	1 cut(s)	253
BpmI	CTGGAG	1 cut(s)	59
BpuEI	CTTGAG	1 cut(s)	256
BsaXI	ACNNNNNCTCC	2 cut(s)	149, 179
Bsc4I	CCNNNNNNNGG	2 cut(s)	79, 174
Bse21I	CCTNAGG	1 cut(s)	173
BseBI	CCWGG	1 cut(s)	253
BseGI	GGATG	1 cut(s)	61
BseLI	CCNNNNNNNGG	2 cut(s)	79, 174
BseMII	CTCAG	1 cut(s)	187
BseRI	GAGGAG	2 cut(s)	62, 80
BseXI	GCAGC	4 cut(s)	3, 22, 124, 202
BsgI	GTGCAG	1 cut(s)	29
BslI	CCNNNNNNNGG	2 cut(s)	79, 174
BsmAI	GTCTC	2 cut(s)	74, 232
BsmBI	CGTCTC	1 cut(s)	74
Bsp143I	GATC	1 cut(s)	51
BspCNI	CTCAG	1 cut(s)	186
BspMAI	CTGCAG	1 cut(s)	114
BspMI	ACCTGC	3 cut(s)	70, 117, 220
BspPI	GGATC	1 cut(s)	59
BssMI	GATC	1 cut(s)	51
Bst2UI	CCWGG	1 cut(s)	253
Bst6I	CTCTTC	1 cut(s)	98
BstAPI	GCANNNNNTGC	1 cut(s)	16
BstC8I	GCNNGC	1 cut(s)	21
BstDEI	CTNAG	1 cut(s)	173
BstENI	CCTNNNNNAGG	2 cut(s)	77, 172
BstF5I	GGATG	1 cut(s)	61
BstH2I	RGCGCY	1 cut(s)	118
BstHHI	GCGC	1 cut(s)	117
BstKTI	GATC	1 cut(s)	54
BstMAI	GTCTC	2 cut(s)	74, 232
BstMBI	GATC	1 cut(s)	51
BstMWI	GCNNNNNNNGC	3 cut(s)	10, 16, 212
BstNI	CCWGG	1 cut(s)	253
BstNSI	RCATGY	1 cut(s)	8
BstSCI	CCNGG	1 cut(s)	251
BstSFI	CTRYAG	1 cut(s)	110
BstV1I	GCAGC	4 cut(s)	3, 22, 124, 202
BstX2I	RGATCY	1 cut(s)	51
BstYI	RGATCY	1 cut(s)	51
Bsu36I	CCTNAGG	1 cut(s)	173
BtsCI	GGATG	1 cut(s)	61
BveI	ACCTGC	3 cut(s)	70, 117, 220
Cac8I	GCNNGC	1 cut(s)	21
CaiI	CAGNNNCTG	1 cut(s)	16
CfoI	GCGC	1 cut(s)	117
Cfr13I	GGNCC	1 cut(s)	177
Csp6I	GTAC	1 cut(s)	273
CviAII	CATG	1 cut(s)	5
CviJI	RGCY	5 cut(s)	13, 23, 41, 143, 206
CviKI_1	RGCY	5 cut(s)	13, 23, 41, 143, 206
CviQI	GTAC	1 cut(s)	273
DdeI	CTNAG	1 cut(s)	173
DpnI	GATC	1 cut(s)	53
DpnII	GATC	1 cut(s)	51
Eam1104I	CTCTTC	1 cut(s)	98
EarI	CTCTTC	1 cut(s)	98
Eco47I	GGWCC	1 cut(s)	177
Eco57I	CTGAAG	1 cut(s)	27
Eco81I	CCTNAGG	1 cut(s)	173
EcoNI	CCTNNNNNAGG	2 cut(s)	77, 172
EcoO109I	RGGNCCY	1 cut(s)	177
EcoRII	CCWGG	1 cut(s)	251
EcoT22I	ATGCAT	1 cut(s)	6
Esp3I	CGTCTC	1 cut(s)	74
FaeI	CATG	1 cut(s)	8
FaiI	YATR	2 cut(s)	6, 203
FalI	AAGNNNNNCTT	1 cut(s)	250
FatI	CATG	1 cut(s)	4
Fnu4HI	GCNGC	5 cut(s)	11, 14, 17, 113, 216
FokI	GGATG	1 cut(s)	48
Fsp4HI	GCNGC	5 cut(s)	11, 14, 17, 113, 216
FspBI	CTAG	1 cut(s)	277
GlaI	GCGC	1 cut(s)	116
GluI	GCNGC	5 cut(s)	11, 14, 17, 113, 216
GsuI	CTGGAG	1 cut(s)	59
HaeII	RGCGCY	1 cut(s)	118
HhaI	GCGC	1 cut(s)	117
Hin1II	CATG	1 cut(s)	8
Hin6I	GCGC	1 cut(s)	115
HinP1I	GCGC	1 cut(s)	115
HinfI	GANTC	1 cut(s)	196
HphI	GGTGA	3 cut(s)	23, 180, 241
Hpy188I	TCNGA	1 cut(s)	46
Hpy188III	TCNNGA	1 cut(s)	175
HpyAV	CCTTC	1 cut(s)	190
HpyCH4V	TGCA	7 cut(s)	4, 10, 19, 105, 112, 218, 229
HpyF10VI	GCNNNNNNNGC	3 cut(s)	10, 16, 212
HpyF3I	CTNAG	1 cut(s)	173
Hsp92II	CATG	1 cut(s)	8
HspAI	GCGC	1 cut(s)	115
Kzo9I	GATC	1 cut(s)	51
LmnI	GCTCC	1 cut(s)	211
Lsp1109I	GCAGC	4 cut(s)	3, 22, 124, 202
MaeI	CTAG	1 cut(s)	277
MalI	GATC	1 cut(s)	53
MboI	GATC	1 cut(s)	51
MboII	GAAGA	1 cut(s)	85
MflI	RGATCY	1 cut(s)	51
MluCI	AATT	1 cut(s)	151
MnlI	CCTC	6 cut(s)	75, 83, 98, 101, 175, 182
Mph1103I	ATGCAT	1 cut(s)	6
MspA1I	CMGCKG	1 cut(s)	13
MspR9I	CCNGG	1 cut(s)	253
MvaI	CCWGG	1 cut(s)	253
MwoI	GCNNNNNNNGC	3 cut(s)	10, 16, 212
NdeII	GATC	1 cut(s)	51
NlaIII	CATG	1 cut(s)	8
NsiI	ATGCAT	1 cut(s)	6
NspI	RCATGY	1 cut(s)	8
PaqCI	CACCTGC	1 cut(s)	220
PfeI	GAWTC	1 cut(s)	196
PkrI	GCNGC	5 cut(s)	12, 15, 18, 114, 217
PpuMI	RGGWCCY	1 cut(s)	177
Psp5II	RGGWCCY	1 cut(s)	177
Psp6I	CCWGG	1 cut(s)	251
PspGI	CCWGG	1 cut(s)	251
PspPI	GGNCC	1 cut(s)	177
PspPPI	RGGWCCY	1 cut(s)	177
PstI	CTGCAG	1 cut(s)	114
PstNI	CAGNNNCTG	1 cut(s)	16
PsuI	RGATCY	1 cut(s)	51
PvuII	CAGCTG	1 cut(s)	13
RsaI	GTAC	1 cut(s)	274
RsaNI	GTAC	1 cut(s)	273
SatI	GCNGC	5 cut(s)	11, 14, 17, 113, 216
Sau3AI	GATC	1 cut(s)	51
Sau96I	GGNCC	1 cut(s)	177
ScrFI	CCNGG	1 cut(s)	253
SfcI	CTRYAG	1 cut(s)	110
SinI	GGWCC	1 cut(s)	177
SmlI	CTYRAG	1 cut(s)	235
SmoI	CTYRAG	1 cut(s)	235
Sse9I	AATT	1 cut(s)	151
SspMI	CTAG	1 cut(s)	277
StyD4I	CCNGG	1 cut(s)	251
TaqI	TCGA	1 cut(s)	139
TasI	AATT	1 cut(s)	151
TfiI	GAWTC	1 cut(s)	196
TseI	GCWGC	5 cut(s)	10, 13, 16, 112, 215
TspDTI	ATGAA	1 cut(s)	85
VpaK11BI	GGWCC	1 cut(s)	177
XagI	CCTNNNNNAGG	2 cut(s)	77, 172
XapI	RAATTY	1 cut(s)	151
XceI	RCATGY	1 cut(s)	8
XspI	CTAG	1 cut(s)	277
Zsp2I	ATGCAT	1 cut(s)	6

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.