Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr12

Orthogroup ID

OG0002875

Physical Location & Seq

Genomic Coordinates Forward (+)

17599711 .. 17600358

Gene Structure 648 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom12g15280.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 489 bp

ATGGTAGAGCCAAATGCTCTCACCATCTCCTTGGATCCAAATAATTATGGCTTTGAAAAAGCCACAAAACAAGGAGCAAATTGGCCACTATCCAACAATCTCCACCTTGGCCAAATTGTACCAAAGTCCATTGGCCTTACGTACCAGCATGCACACTCTGAATCAACCTCGTTGGTCCTGTTCCGATTCAGTCACTGCCAATGCATGTGCAGCTGCTGCAAGCAAAAAAAACATTTAGCTTCAGACAGGATCTCGACACATCCTCGTCTCCTCCAGCAGGTTTTCCTCCTCTTCATTGTCTGCAACTTGGAAACTTATCAGTGCACCCATTTCCAACAACACCCGTCGAGCCAGACAAACATTCCTCACACTTCCTCCTACCTCAGGACCTTCTCATCACCTGTGAATCCCATAACTCCACCTGCTGCAAAACCCCTGCAACACTTGAGACTAAACATCACCAGGAGAAGTGTTGCTTCGAGTACCTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

QWRF

Protein Analysis

163

Amino Acids

18.23

Weight (kDa)

9.37

Isoelectric Point (pI)

49.01

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002875)

Species	Orthologous Gene IDs
pyrus_communis	pycom03g02900 pycom03g18040 pycom03g21830 pycom04g14340 pycom05g02500 pycom05g05350 pycom05g13410 pycom05g18620 pycom06g02350 pycom06g08160 pycom06g19050 pycom07g14020 pycom08g08130 pycom09g01870 pycom09g08440 pycom10g07570 pycom10g09370 pycom10g19140 pycom10g26070 pycom11g06270 pycom11g15940 pycom11g27190 pycom12g05510 pycom12g14550 pycom12g15280 pycom12g19100 pycom12g22220 pycom13g04640 pycom13g08110 pycom13g09300 pycom14g16880 pycom15g17640 pycom15g27350 pycom15g29140 pycom15g32610 pycom15g36040 pycom16g08180 pycom16g24920 pycom17g05460

Species

Orthologous Gene IDs

pyrus_communis

pycom03g02900 pycom03g18040 pycom03g21830 pycom04g14340 pycom05g02500 pycom05g05350 pycom05g13410 pycom05g18620 pycom06g02350 pycom06g08160 pycom06g19050 pycom07g14020 pycom08g08130 pycom09g01870 pycom09g08440 pycom10g07570 pycom10g09370 pycom10g19140 pycom10g26070 pycom11g06270 pycom11g15940 pycom11g27190 pycom12g05510 pycom12g14550 pycom12g15280 pycom12g19100 pycom12g22220 pycom13g04640 pycom13g08110 pycom13g09300 pycom14g16880 pycom15g17640 pycom15g27350 pycom15g29140 pycom15g32610 pycom15g36040 pycom16g08180 pycom16g24920 pycom17g05460

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	430
Acc36I	ACCTGC	2 cut(s)	268, 430
AclWI	GGATC	3 cut(s)	29, 42, 257
AcoI	YGGCCR	2 cut(s)	83, 109
AcuI	CTGAAG	1 cut(s)	225
AfaI	GTAC	3 cut(s)	120, 143, 484
AfiI	CCNNNNNNNGG	2 cut(s)	277, 384
AgsI	TTSAA	1 cut(s)	56
AjnI	CCWGG	1 cut(s)	461
AluBI	AGCT	2 cut(s)	213, 239
AluI	AGCT	2 cut(s)	213, 239
Alw21I	GWGCWC	1 cut(s)	326
Alw26I	GTCTC	2 cut(s)	272, 442
Alw44I	GTGCAC	1 cut(s)	322
AlwI	GGATC	3 cut(s)	29, 42, 257
AlwNI	CAGNNNCTG	2 cut(s)	195, 216
AoxI	GGCC	3 cut(s)	83, 109, 133
ApaLI	GTGCAC	1 cut(s)	322
ApeKI	GCWGC	4 cut(s)	210, 213, 216, 425
AspS9I	GGNCC	2 cut(s)	175, 387
AsuHPI	GGTGA	3 cut(s)	13, 390, 451
AvaII	GGWCC	2 cut(s)	175, 387
AxyI	CCTNAGG	1 cut(s)	383
BaeGI	GKGCMC	1 cut(s)	326
BalI	TGGCCA	2 cut(s)	85, 111
BamHI	GGATCC	1 cut(s)	34
Bbv12I	GWGCWC	1 cut(s)	326
BbvI	GCAGC	4 cut(s)	200, 203, 222, 412
BccI	CCATC	1 cut(s)	32
BciT130I	CCWGG	1 cut(s)	463
BcoDI	GTCTC	2 cut(s)	272, 442
BfaI	CTAG	1 cut(s)	487
BfuAI	ACCTGC	2 cut(s)	268, 430
BisI	GCNGC	4 cut(s)	211, 214, 217, 426
BlsI	GCNGC	4 cut(s)	212, 215, 218, 427
Bme1390I	CCNGG	1 cut(s)	463
Bme18I	GGWCC	2 cut(s)	175, 387
BmgT120I	GGNCC	2 cut(s)	175, 387
BmiI	GGNNCC	1 cut(s)	36
BmrFI	CCNGG	1 cut(s)	463
BpmI	CTGGAG	1 cut(s)	257
BpuEI	CTTGAG	1 cut(s)	466
BsaAI	YACGTR	1 cut(s)	141
BsaJI	CCNNGG	2 cut(s)	30, 106
BsaXI	ACNNNNNCTCC	2 cut(s)	359, 389
Bsc4I	CCNNNNNNNGG	2 cut(s)	277, 384
Bse21I	CCTNAGG	1 cut(s)	383
BseBI	CCWGG	1 cut(s)	463
BseDI	CCNNGG	2 cut(s)	30, 106
BseGI	GGATG	1 cut(s)	259
BseLI	CCNNNNNNNGG	2 cut(s)	277, 384
BseMII	CTCAG	1 cut(s)	397
BseRI	GAGGAG	2 cut(s)	260, 278
BseSI	GKGCMC	1 cut(s)	326
BseXI	GCAGC	4 cut(s)	200, 203, 222, 412
BsgI	GTGCAG	1 cut(s)	229
BshFI	GGCC	3 cut(s)	85, 111, 135
BsiHKAI	GWGCWC	1 cut(s)	326
BslI	CCNNNNNNNGG	2 cut(s)	277, 384
BsmAI	GTCTC	2 cut(s)	272, 442
BsmBI	CGTCTC	1 cut(s)	272
BsnI	GGCC	3 cut(s)	85, 111, 135
Bsp1286I	GDGCHC	1 cut(s)	326
Bsp143I	GATC	2 cut(s)	34, 249
BspANI	GGCC	3 cut(s)	85, 111, 135
BspCNI	CTCAG	1 cut(s)	396
BspLI	GGNNCC	1 cut(s)	36
BspMI	ACCTGC	2 cut(s)	268, 430
BspPI	GGATC	3 cut(s)	29, 42, 257
BssECI	CCNNGG	2 cut(s)	30, 106
BssMI	GATC	2 cut(s)	34, 249
BssT1I	CCWWGG	2 cut(s)	30, 106
Bst2UI	CCWGG	1 cut(s)	463
Bst6I	CTCTTC	1 cut(s)	296
BstAPI	GCANNNNNTGC	1 cut(s)	216
BstBAI	YACGTR	1 cut(s)	141
BstC8I	GCNNGC	2 cut(s)	150, 221
BstDEI	CTNAG	1 cut(s)	383
BstENI	CCTNNNNNAGG	2 cut(s)	275, 382
BstF5I	GGATG	1 cut(s)	259
BstKTI	GATC	2 cut(s)	37, 252
BstMAI	GTCTC	2 cut(s)	272, 442
BstMBI	GATC	2 cut(s)	34, 249
BstMWI	GCNNNNNNNGC	2 cut(s)	210, 216
BstNI	CCWGG	1 cut(s)	463
BstNSI	RCATGY	2 cut(s)	152, 208
BstSCI	CCNGG	1 cut(s)	461
BstSLI	GKGCMC	1 cut(s)	326
BstSNI	TACGTA	1 cut(s)	141
BstV1I	GCAGC	4 cut(s)	200, 203, 222, 412
BstX2I	RGATCY	2 cut(s)	34, 249
BstXI	CCANNNNNNTGG	1 cut(s)	31
BstYI	RGATCY	2 cut(s)	34, 249
Bsu36I	CCTNAGG	1 cut(s)	383
BsuRI	GGCC	3 cut(s)	85, 111, 135
BtsCI	GGATG	1 cut(s)	259
BtsI	GCAGTG	1 cut(s)	193
BtsIMutI	CAGTG	2 cut(s)	193, 326
BveI	ACCTGC	2 cut(s)	268, 430
Cac8I	GCNNGC	2 cut(s)	150, 221
CaiI	CAGNNNCTG	2 cut(s)	195, 216
Cfr13I	GGNCC	2 cut(s)	175, 387
Csp6I	GTAC	3 cut(s)	119, 142, 483
CviAII	CATG	2 cut(s)	149, 205
CviJI	RGCY	9 cut(s)	10, 51, 62, 85, 111, 135, 213, 239, 351
CviKI_1	RGCY	9 cut(s)	10, 51, 62, 85, 111, 135, 213, 239, 351
CviQI	GTAC	3 cut(s)	119, 142, 483
DdeI	CTNAG	1 cut(s)	383
DpnI	GATC	2 cut(s)	36, 251
DpnII	GATC	2 cut(s)	34, 249
EaeI	YGGCCR	2 cut(s)	83, 109
Eam1104I	CTCTTC	1 cut(s)	296
EarI	CTCTTC	1 cut(s)	296
Eco105I	TACGTA	1 cut(s)	141
Eco130I	CCWWGG	2 cut(s)	30, 106
Eco47I	GGWCC	2 cut(s)	175, 387
Eco57I	CTGAAG	1 cut(s)	225
Eco81I	CCTNAGG	1 cut(s)	383
EcoNI	CCTNNNNNAGG	2 cut(s)	275, 382
EcoO109I	RGGNCCY	1 cut(s)	387
EcoRII	CCWGG	1 cut(s)	461
EcoT14I	CCWWGG	2 cut(s)	30, 106
EcoT22I	ATGCAT	1 cut(s)	206
ErhI	CCWWGG	2 cut(s)	30, 106
Esp3I	CGTCTC	1 cut(s)	272
FaeI	CATG	2 cut(s)	152, 208
FaiI	YATR	4 cut(s)	48, 150, 206, 413
FalI	AAGNNNNNCTT	1 cut(s)	460
FatI	CATG	2 cut(s)	148, 204
Fnu4HI	GCNGC	4 cut(s)	211, 214, 217, 426
FokI	GGATG	1 cut(s)	246
Fsp4HI	GCNGC	4 cut(s)	211, 214, 217, 426
FspBI	CTAG	1 cut(s)	487
GluI	GCNGC	4 cut(s)	211, 214, 217, 426
GsuI	CTGGAG	1 cut(s)	257
HaeIII	GGCC	3 cut(s)	85, 111, 135
Hin1II	CATG	2 cut(s)	152, 208
HinfI	GANTC	3 cut(s)	161, 186, 406
HphI	GGTGA	3 cut(s)	13, 390, 451
Hpy166II	GTNNAC	1 cut(s)	324
Hpy188I	TCNGA	3 cut(s)	160, 185, 244
Hpy188III	TCNNGA	2 cut(s)	253, 385
Hpy8I	GTNNAC	1 cut(s)	324
Hpy99I	CGWCG	1 cut(s)	349
HpyAV	CCTTC	1 cut(s)	400
HpyCH4IV	ACGT	1 cut(s)	140
HpyCH4V	TGCA	8 cut(s)	152, 204, 210, 219, 303, 324, 428, 439
HpyF10VI	GCNNNNNNNGC	2 cut(s)	210, 216
HpyF3I	CTNAG	1 cut(s)	383
HpySE526I	ACGT	1 cut(s)	140
Hsp92II	CATG	2 cut(s)	152, 208
Kzo9I	GATC	2 cut(s)	34, 249
LmnI	GCTCC	1 cut(s)	74
Lsp1109I	GCAGC	4 cut(s)	200, 203, 222, 412
MaeI	CTAG	1 cut(s)	487
MaeII	ACGT	1 cut(s)	140
MaeIII	GTNAC	1 cut(s)	191
MalI	GATC	2 cut(s)	36, 251
MboI	GATC	2 cut(s)	34, 249
MboII	GAAGA	1 cut(s)	283
MflI	RGATCY	2 cut(s)	34, 249
MhlI	GDGCHC	1 cut(s)	326
MlsI	TGGCCA	2 cut(s)	85, 111
MluCI	AATT	3 cut(s)	43, 79, 114
MluNI	TGGCCA	2 cut(s)	85, 111
MmeI	TCCRAC	2 cut(s)	117, 358
MnlI	CCTC	8 cut(s)	178, 273, 281, 296, 299, 375, 385, 392
Mox20I	TGGCCA	2 cut(s)	85, 111
Mph1103I	ATGCAT	1 cut(s)	206
MscI	TGGCCA	2 cut(s)	85, 111
Msp20I	TGGCCA	2 cut(s)	85, 111
MspA1I	CMGCKG	1 cut(s)	213
MspR9I	CCNGG	1 cut(s)	463
MvaI	CCWGG	1 cut(s)	463
MwoI	GCNNNNNNNGC	2 cut(s)	210, 216
NdeII	GATC	2 cut(s)	34, 249
NlaIII	CATG	2 cut(s)	152, 208
NlaIV	GGNNCC	1 cut(s)	36
NmuCI	GTSAC	1 cut(s)	191
NsiI	ATGCAT	1 cut(s)	206
NspI	RCATGY	2 cut(s)	152, 208
PaeI	GCATGC	1 cut(s)	152
PaqCI	CACCTGC	1 cut(s)	430
PfeI	GAWTC	3 cut(s)	161, 186, 406
PkrI	GCNGC	4 cut(s)	212, 215, 218, 427
Ppu21I	YACGTR	1 cut(s)	141
PpuMI	RGGWCCY	1 cut(s)	387
Psp5II	RGGWCCY	1 cut(s)	387
Psp6I	CCWGG	1 cut(s)	461
PspGI	CCWGG	1 cut(s)	461
PspN4I	GGNNCC	1 cut(s)	36
PspPI	GGNCC	2 cut(s)	175, 387
PspPPI	RGGWCCY	1 cut(s)	387
PstNI	CAGNNNCTG	2 cut(s)	195, 216
PsuI	RGATCY	2 cut(s)	34, 249
PvuII	CAGCTG	1 cut(s)	213
RsaI	GTAC	3 cut(s)	120, 143, 484
RsaNI	GTAC	3 cut(s)	119, 142, 483
SatI	GCNGC	4 cut(s)	211, 214, 217, 426
Sau3AI	GATC	2 cut(s)	34, 249
Sau96I	GGNCC	2 cut(s)	175, 387
ScrFI	CCNGG	1 cut(s)	463
SduI	GDGCHC	1 cut(s)	326
SinI	GGWCC	2 cut(s)	175, 387
SmlI	CTYRAG	1 cut(s)	445
SmoI	CTYRAG	1 cut(s)	445
SnaBI	TACGTA	1 cut(s)	141
SphI	GCATGC	1 cut(s)	152
Sse9I	AATT	3 cut(s)	43, 79, 114
SspMI	CTAG	1 cut(s)	487
StyD4I	CCNGG	1 cut(s)	461
StyI	CCWWGG	2 cut(s)	30, 106
TaiI	ACGT	1 cut(s)	143
TaqI	TCGA	3 cut(s)	254, 347, 479
TasI	AATT	3 cut(s)	43, 79, 114
TfiI	GAWTC	3 cut(s)	161, 186, 406
TscAI	CASTG	2 cut(s)	200, 326
TseFI	GTSAC	1 cut(s)	191
TseI	GCWGC	4 cut(s)	210, 213, 216, 425
Tsp45I	GTSAC	1 cut(s)	191
TspDTI	ATGAA	1 cut(s)	283
TspRI	CASTG	2 cut(s)	200, 326
VneI	GTGCAC	1 cut(s)	322
VpaK11BI	GGWCC	2 cut(s)	175, 387
XagI	CCTNNNNNAGG	2 cut(s)	275, 382
XceI	RCATGY	2 cut(s)	152, 208
XspI	CTAG	1 cut(s)	487
Zsp2I	ATGCAT	1 cut(s)	206

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.