Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr8

Orthogroup ID

OG0002875

Physical Location & Seq

Genomic Coordinates Reverse (-)

6568328 .. 6568666

Gene Structure 339 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom08g08130.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 339 bp

ATGTGCAGCTGCTGCAAGCAAAAAAAGCATTTAGCTTCAGACAGGATCTCGACACATCCTCGTCTCCTCCAGCAGGTTTTCCTCATCTTCATTGTCTGCAACTTGGAAACTTGTCAGTGCACCCATTTCCAGCAACACCCGTCGAGCCAGACAAACATTCCTCACTTCCTCCTACCTCAGGACCTTCTCATCACCTGTGAATCCCATAGCTCCACCTGCTGCAAAACCCCTGCAACACTTGAGACTAAACATCACCAGGAGAAGTGTTGCTTCGAGTACCTAGAGGTCATACTCAAAGGCTTCCACCACAAACTTGCTAACCCGGCCTTGCACCCGTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

QWRF

Protein Analysis

113

Amino Acids

12.86

Weight (kDa)

8.04

Isoelectric Point (pI)

39.99

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002875)

Species	Orthologous Gene IDs
pyrus_communis	pycom03g02900 pycom03g18040 pycom03g21830 pycom04g14340 pycom05g02500 pycom05g05350 pycom05g13410 pycom05g18620 pycom06g02350 pycom06g08160 pycom06g19050 pycom07g14020 pycom08g08130 pycom09g01870 pycom09g08440 pycom10g07570 pycom10g09370 pycom10g19140 pycom10g26070 pycom11g06270 pycom11g15940 pycom11g27190 pycom12g05510 pycom12g14550 pycom12g15280 pycom12g19100 pycom12g22220 pycom13g04640 pycom13g08110 pycom13g09300 pycom14g16880 pycom15g17640 pycom15g27350 pycom15g29140 pycom15g32610 pycom15g36040 pycom16g08180 pycom16g24920 pycom17g05460

Species

Orthologous Gene IDs

pyrus_communis

pycom03g02900 pycom03g18040 pycom03g21830 pycom04g14340 pycom05g02500 pycom05g05350 pycom05g13410 pycom05g18620 pycom06g02350 pycom06g08160 pycom06g19050 pycom07g14020 pycom08g08130 pycom09g01870 pycom09g08440 pycom10g07570 pycom10g09370 pycom10g19140 pycom10g26070 pycom11g06270 pycom11g15940 pycom11g27190 pycom12g05510 pycom12g14550 pycom12g15280 pycom12g19100 pycom12g22220 pycom13g04640 pycom13g08110 pycom13g09300 pycom14g16880 pycom15g17640 pycom15g27350 pycom15g29140 pycom15g32610 pycom15g36040 pycom16g08180 pycom16g24920 pycom17g05460

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	224
Acc36I	ACCTGC	2 cut(s)	64, 224
AclWI	GGATC	1 cut(s)	53
AcuI	CTGAAG	1 cut(s)	21
AfaI	GTAC	1 cut(s)	278
AfiI	CCNNNNNNNGG	2 cut(s)	73, 178
AjnI	CCWGG	1 cut(s)	255
AluBI	AGCT	3 cut(s)	9, 35, 210
AluI	AGCT	3 cut(s)	9, 35, 210
Alw21I	GWGCWC	1 cut(s)	122
Alw26I	GTCTC	2 cut(s)	68, 236
Alw44I	GTGCAC	1 cut(s)	118
AlwI	GGATC	1 cut(s)	53
AlwNI	CAGNNNCTG	1 cut(s)	12
AoxI	GGCC	1 cut(s)	324
ApaLI	GTGCAC	1 cut(s)	118
ApeKI	GCWGC	4 cut(s)	6, 9, 12, 219
AspS9I	GGNCC	1 cut(s)	181
AsuC2I	CCSGG	1 cut(s)	323
AsuHPI	GGTGA	2 cut(s)	184, 245
AvaII	GGWCC	1 cut(s)	181
AxyI	CCTNAGG	1 cut(s)	177
BaeGI	GKGCMC	1 cut(s)	122
Bbv12I	GWGCWC	1 cut(s)	122
BbvI	GCAGC	2 cut(s)	18, 206
BciT130I	CCWGG	1 cut(s)	257
BcnI	CCSGG	1 cut(s)	323
BcoDI	GTCTC	2 cut(s)	68, 236
BfaI	CTAG	1 cut(s)	281
BfuAI	ACCTGC	2 cut(s)	64, 224
BisI	GCNGC	4 cut(s)	7, 10, 13, 220
BlsI	GCNGC	4 cut(s)	8, 11, 14, 221
Bme1390I	CCNGG	2 cut(s)	257, 323
Bme18I	GGWCC	1 cut(s)	181
BmgT120I	GGNCC	1 cut(s)	181
BmrFI	CCNGG	2 cut(s)	257, 323
BpmI	CTGGAG	1 cut(s)	53
BpuEI	CTTGAG	1 cut(s)	260
BpuMI	CCSGG	1 cut(s)	323
Bsc4I	CCNNNNNNNGG	2 cut(s)	73, 178
Bse21I	CCTNAGG	1 cut(s)	177
BseBI	CCWGG	1 cut(s)	257
BseGI	GGATG	1 cut(s)	55
BseLI	CCNNNNNNNGG	2 cut(s)	73, 178
BseMII	CTCAG	1 cut(s)	191
BseRI	GAGGAG	1 cut(s)	56
BseSI	GKGCMC	1 cut(s)	122
BseXI	GCAGC	2 cut(s)	18, 206
BsgI	GTGCAG	1 cut(s)	25
BshFI	GGCC	1 cut(s)	326
BsiHKAI	GWGCWC	1 cut(s)	122
BsiSI	CCGG	1 cut(s)	323
BslI	CCNNNNNNNGG	2 cut(s)	73, 178
BsmAI	GTCTC	2 cut(s)	68, 236
BsmBI	CGTCTC	1 cut(s)	68
BsnI	GGCC	1 cut(s)	326
Bsp1286I	GDGCHC	1 cut(s)	122
Bsp143I	GATC	1 cut(s)	45
BspANI	GGCC	1 cut(s)	326
BspCNI	CTCAG	1 cut(s)	190
BspMI	ACCTGC	2 cut(s)	64, 224
BspPI	GGATC	1 cut(s)	53
BssMI	GATC	1 cut(s)	45
Bst2UI	CCWGG	1 cut(s)	257
BstAPI	GCANNNNNTGC	1 cut(s)	12
BstC8I	GCNNGC	1 cut(s)	17
BstDEI	CTNAG	1 cut(s)	177
BstENI	CCTNNNNNAGG	2 cut(s)	71, 176
BstF5I	GGATG	1 cut(s)	55
BstKTI	GATC	1 cut(s)	48
BstMAI	GTCTC	2 cut(s)	68, 236
BstMBI	GATC	1 cut(s)	45
BstMWI	GCNNNNNNNGC	4 cut(s)	12, 25, 216, 323
BstNI	CCWGG	1 cut(s)	257
BstSCI	CCNGG	2 cut(s)	255, 321
BstSLI	GKGCMC	1 cut(s)	122
BstV1I	GCAGC	2 cut(s)	18, 206
BstX2I	RGATCY	1 cut(s)	45
BstYI	RGATCY	1 cut(s)	45
Bsu36I	CCTNAGG	1 cut(s)	177
BsuRI	GGCC	1 cut(s)	326
BtsCI	GGATG	1 cut(s)	55
BtsIMutI	CAGTG	1 cut(s)	122
BveI	ACCTGC	2 cut(s)	64, 224
Cac8I	GCNNGC	1 cut(s)	17
CaiI	CAGNNNCTG	1 cut(s)	12
Cfr13I	GGNCC	1 cut(s)	181
Csp6I	GTAC	1 cut(s)	277
CviJI	RGCY	6 cut(s)	9, 35, 147, 210, 300, 326
CviKI_1	RGCY	6 cut(s)	9, 35, 147, 210, 300, 326
CviQI	GTAC	1 cut(s)	277
DdeI	CTNAG	1 cut(s)	177
DpnI	GATC	1 cut(s)	47
DpnII	GATC	1 cut(s)	45
Eco47I	GGWCC	1 cut(s)	181
Eco57I	CTGAAG	1 cut(s)	21
Eco81I	CCTNAGG	1 cut(s)	177
EcoNI	CCTNNNNNAGG	2 cut(s)	71, 176
EcoO109I	RGGNCCY	1 cut(s)	181
EcoRII	CCWGG	1 cut(s)	255
Esp3I	CGTCTC	1 cut(s)	68
FaiI	YATR	2 cut(s)	207, 290
FalI	AAGNNNNNCTT	2 cut(s)	254, 286
Fnu4HI	GCNGC	4 cut(s)	7, 10, 13, 220
FokI	GGATG	1 cut(s)	42
Fsp4HI	GCNGC	4 cut(s)	7, 10, 13, 220
FspBI	CTAG	1 cut(s)	281
GluI	GCNGC	4 cut(s)	7, 10, 13, 220
GsuI	CTGGAG	1 cut(s)	53
HaeIII	GGCC	1 cut(s)	326
HapII	CCGG	1 cut(s)	323
HinfI	GANTC	1 cut(s)	200
HpaII	CCGG	1 cut(s)	323
HphI	GGTGA	2 cut(s)	184, 245
Hpy166II	GTNNAC	1 cut(s)	120
Hpy188I	TCNGA	1 cut(s)	40
Hpy188III	TCNNGA	2 cut(s)	49, 179
Hpy8I	GTNNAC	1 cut(s)	120
Hpy99I	CGWCG	1 cut(s)	145
HpyAV	CCTTC	1 cut(s)	194
HpyCH4V	TGCA	7 cut(s)	6, 15, 99, 120, 222, 233, 331
HpyF10VI	GCNNNNNNNGC	4 cut(s)	12, 25, 216, 323
HpyF3I	CTNAG	1 cut(s)	177
Kzo9I	GATC	1 cut(s)	45
LmnI	GCTCC	1 cut(s)	215
Lsp1109I	GCAGC	2 cut(s)	18, 206
MaeI	CTAG	1 cut(s)	281
MalI	GATC	1 cut(s)	47
MboI	GATC	1 cut(s)	45
MboII	GAAGA	1 cut(s)	79
MflI	RGATCY	1 cut(s)	45
MhlI	GDGCHC	1 cut(s)	122
MnlI	CCTC	7 cut(s)	69, 77, 92, 171, 179, 186, 277
MspA1I	CMGCKG	1 cut(s)	9
MspI	CCGG	1 cut(s)	323
MspR9I	CCNGG	2 cut(s)	257, 323
MvaI	CCWGG	1 cut(s)	257
MwoI	GCNNNNNNNGC	4 cut(s)	12, 25, 216, 323
NciI	CCSGG	1 cut(s)	323
NdeII	GATC	1 cut(s)	45
PaqCI	CACCTGC	1 cut(s)	224
PfeI	GAWTC	1 cut(s)	200
PkrI	GCNGC	4 cut(s)	8, 11, 14, 221
PpuMI	RGGWCCY	1 cut(s)	181
Psp5II	RGGWCCY	1 cut(s)	181
Psp6I	CCWGG	1 cut(s)	255
PspGI	CCWGG	1 cut(s)	255
PspPI	GGNCC	1 cut(s)	181
PspPPI	RGGWCCY	1 cut(s)	181
PstNI	CAGNNNCTG	1 cut(s)	12
PsuI	RGATCY	1 cut(s)	45
PvuII	CAGCTG	1 cut(s)	9
RsaI	GTAC	1 cut(s)	278
RsaNI	GTAC	1 cut(s)	277
SatI	GCNGC	4 cut(s)	7, 10, 13, 220
Sau3AI	GATC	1 cut(s)	45
Sau96I	GGNCC	1 cut(s)	181
ScrFI	CCNGG	2 cut(s)	257, 323
SduI	GDGCHC	1 cut(s)	122
SinI	GGWCC	1 cut(s)	181
SmlI	CTYRAG	1 cut(s)	239
SmoI	CTYRAG	1 cut(s)	239
SspMI	CTAG	1 cut(s)	281
StyD4I	CCNGG	2 cut(s)	255, 321
TaqI	TCGA	3 cut(s)	50, 143, 273
TfiI	GAWTC	1 cut(s)	200
TscAI	CASTG	1 cut(s)	122
TseI	GCWGC	4 cut(s)	6, 9, 12, 219
TspDTI	ATGAA	1 cut(s)	79
TspRI	CASTG	1 cut(s)	122
VneI	GTGCAC	1 cut(s)	118
VpaK11BI	GGWCC	1 cut(s)	181
XagI	CCTNNNNNAGG	2 cut(s)	71, 176
XspI	CTAG	1 cut(s)	281

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.