pycom07g09010

Plant non-specific lipid-transfer proteins transfer phospholipids as well as galactolipids across membranes. May play a role in wax or cutin deposition in the cell walls of expanding epidermal cells and certain secretory tissues

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr7
OG0008059
Physical Location & Seq
Reverse (-)
8188508 .. 8188873
366 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom07g09010.1

Sequence Viewer

Length: 366 bp
ATGATGAAGGGCATTGTGATCCCAATATTGGTTCTGCTAGCCGTGGCTCACCTAATGGTGCAGCAAGGAGAGGTCGTTGTCTCTTGTGGCCAGGTGGACTCGACCAAACGGGGTAATCTTGACCCGGCTTGCTGCACCGGGGCGCAGAACATCAAGAACCTCGCCCAAACCACAGCTGATAAGCAGGCCGCTTGTGAATGCTGTAAGGCAGCGGCAAACCACTTCCCCAATGTTGACGAAGTTACAGCTTCTACTCTCCCAGGCAAGTGTGGGATTGAGATGAATATCCCCATCTCAATGACCACCAACTTGCTAATTAACTTTTCGCTTTTTTCTTGGACCAGCATCAGCCTAAGATGGAGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LTP_2 Tryp_alpha_amyl

Protein Analysis

122

Amino Acids

12.98

Weight (kDa)

7.56

Isoelectric Point (pI)

38.53

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Tryp_alpha_amyl PF00234 26 - 94 3.4e-07 Protease inhibitor/seed storage/LTP family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 189, 212
AclWI GGATC 1 cut(s) 13
AcoI YGGCCR 1 cut(s) 88
AfiI CCNNNNNNNGG 1 cut(s) 28
AjnI CCWGG 2 cut(s) 90, 259
AluBI AGCT 2 cut(s) 176, 248
AluI AGCT 2 cut(s) 176, 248
Alw26I GTCTC 1 cut(s) 85
AlwI GGATC 1 cut(s) 13
AoxI GGCC 2 cut(s) 88, 186
ApeKI GCWGC 3 cut(s) 61, 132, 209
AspLEI GCGC 1 cut(s) 145
AspS9I GGNCC 1 cut(s) 339
AsuC2I CCSGG 2 cut(s) 125, 139
AsuHPI GGTGA 1 cut(s) 41
AsuNHI GCTAGC 1 cut(s) 37
AvaII GGWCC 1 cut(s) 339
BalI TGGCCA 1 cut(s) 90
BbvI GCAGC 3 cut(s) 73, 119, 221
BccI CCATC 2 cut(s) 299, 351
BceAI ACGGC 1 cut(s) 26
BciT130I CCWGG 2 cut(s) 92, 261
BcnI CCSGG 2 cut(s) 125, 139
BcoDI GTCTC 1 cut(s) 85
BfaI CTAG 1 cut(s) 38
BisI GCNGC 5 cut(s) 62, 133, 189, 210, 213
BlsI GCNGC 5 cut(s) 63, 134, 190, 211, 214
Bme1390I CCNGG 4 cut(s) 92, 125, 139, 261
Bme18I GGWCC 1 cut(s) 339
BmgT120I GGNCC 1 cut(s) 339
BmrFI CCNGG 4 cut(s) 92, 125, 139, 261
BmsI GCATC 1 cut(s) 354
BmtI GCTAGC 1 cut(s) 41
BpuMI CCSGG 2 cut(s) 125, 139
BsaBI GATNNNNATC 1 cut(s) 284
BsaJI CCNNGG 3 cut(s) 42, 138, 259
BsaXI ACNNNNNCTCC 2 cut(s) 60, 90
Bsc4I CCNNNNNNNGG 1 cut(s) 28
Bse8I GATNNNNATC 1 cut(s) 284
BseBI CCWGG 2 cut(s) 92, 261
BseDI CCNNGG 3 cut(s) 42, 138, 259
BseJI GATNNNNATC 1 cut(s) 284
BseLI CCNNNNNNNGG 1 cut(s) 28
BseXI GCAGC 3 cut(s) 73, 119, 221
BsgI GTGCAG 2 cut(s) 80, 118
BshFI GGCC 2 cut(s) 90, 188
BsiSI CCGG 2 cut(s) 125, 138
BslI CCNNNNNNNGG 1 cut(s) 28
BsmAI GTCTC 1 cut(s) 85
BsmI GAATGC 1 cut(s) 203
BsnI GGCC 2 cut(s) 90, 188
Bsp143I GATC 1 cut(s) 18
BspACI CCGC 2 cut(s) 189, 212
BspANI GGCC 2 cut(s) 90, 188
BspOI GCTAGC 1 cut(s) 41
BspPI GGATC 1 cut(s) 13
BssECI CCNNGG 3 cut(s) 42, 138, 259
BssMI GATC 1 cut(s) 18
Bst2UI CCWGG 2 cut(s) 92, 261
BstC8I GCNNGC 3 cut(s) 39, 130, 186
BstDEI CTNAG 1 cut(s) 353
BstDSI CCRYGG 1 cut(s) 42
BstHHI GCGC 1 cut(s) 145
BstKTI GATC 1 cut(s) 21
BstMAI GTCTC 1 cut(s) 85
BstMBI GATC 1 cut(s) 18
BstNI CCWGG 2 cut(s) 92, 261
BstSCI CCNGG 4 cut(s) 90, 123, 137, 259
BstV1I GCAGC 3 cut(s) 73, 119, 221
BsuRI GGCC 2 cut(s) 90, 188
BtgI CCRYGG 1 cut(s) 42
Cac8I GCNNGC 3 cut(s) 39, 130, 186
CfoI GCGC 1 cut(s) 145
Cfr13I GGNCC 1 cut(s) 339
CviJI RGCY 8 cut(s) 41, 47, 90, 128, 176, 188, 248, 351
CviKI_1 RGCY 8 cut(s) 41, 47, 90, 128, 176, 188, 248, 351
DdeI CTNAG 1 cut(s) 353
DpnI GATC 1 cut(s) 20
DpnII GATC 1 cut(s) 18
EaeI YGGCCR 1 cut(s) 88
Eco47I GGWCC 1 cut(s) 339
EcoRII CCWGG 2 cut(s) 90, 259
Fnu4HI GCNGC 5 cut(s) 62, 133, 189, 210, 213
Fsp4HI GCNGC 5 cut(s) 62, 133, 189, 210, 213
FspBI CTAG 1 cut(s) 38
GlaI GCGC 1 cut(s) 144
GluI GCNGC 5 cut(s) 62, 133, 189, 210, 213
HaeIII GGCC 2 cut(s) 90, 188
HapII CCGG 2 cut(s) 125, 138
HhaI GCGC 1 cut(s) 145
Hin6I GCGC 1 cut(s) 143
HinP1I GCGC 1 cut(s) 143
HincII GTYRAC 1 cut(s) 235
HindII GTYRAC 1 cut(s) 235
HinfI GANTC 1 cut(s) 98
HpaII CCGG 2 cut(s) 125, 138
HphI GGTGA 1 cut(s) 41
Hpy166II GTNNAC 2 cut(s) 97, 235
Hpy188III TCNNGA 2 cut(s) 119, 154
Hpy8I GTNNAC 2 cut(s) 97, 235
HpyCH4V TGCA 2 cut(s) 61, 135
HpyF3I CTNAG 1 cut(s) 353
HspAI GCGC 1 cut(s) 143
Kzo9I GATC 1 cut(s) 18
LpnPI CCDG 8 cut(s) 77, 104, 138, 151, 170, 246, 273, 355
Lsp1109I GCAGC 3 cut(s) 73, 119, 221
LweI GCATC 1 cut(s) 354
MaeI CTAG 1 cut(s) 38
MaeIII GTNAC 1 cut(s) 241
MalI GATC 1 cut(s) 20
MboI GATC 1 cut(s) 18
MlsI TGGCCA 1 cut(s) 90
MluCI AATT 1 cut(s) 315
MluNI TGGCCA 1 cut(s) 90
MlyI GAGTC 1 cut(s) 92
MnlI CCTC 3 cut(s) 64, 170, 354
Mox20I TGGCCA 1 cut(s) 90
MscI TGGCCA 1 cut(s) 90
MseI TTAA 1 cut(s) 318
MslI CAYNNNNRTG 1 cut(s) 296
Msp20I TGGCCA 1 cut(s) 90
MspA1I CMGCKG 2 cut(s) 176, 212
MspI CCGG 2 cut(s) 125, 138
MspR9I CCNGG 4 cut(s) 92, 125, 139, 261
Mva1269I GAATGC 1 cut(s) 203
MvaI CCWGG 2 cut(s) 92, 261
NciI CCSGG 2 cut(s) 125, 139
NdeII GATC 1 cut(s) 18
NheI GCTAGC 1 cut(s) 37
PctI GAATGC 1 cut(s) 203
PkrI GCNGC 5 cut(s) 63, 134, 190, 211, 214
PleI GAGTC 1 cut(s) 92
PpsI GAGTC 1 cut(s) 92
Psp6I CCWGG 2 cut(s) 90, 259
PspGI CCWGG 2 cut(s) 90, 259
PspPI GGNCC 1 cut(s) 339
PvuII CAGCTG 1 cut(s) 176
RseI CAYNNNNRTG 1 cut(s) 296
SaqAI TTAA 1 cut(s) 318
SatI GCNGC 5 cut(s) 62, 133, 189, 210, 213
Sau3AI GATC 1 cut(s) 18
Sau96I GGNCC 1 cut(s) 339
SchI GAGTC 1 cut(s) 92
ScrFI CCNGG 4 cut(s) 92, 125, 139, 261
SetI ASST 7 cut(s) 54, 75, 96, 162, 178, 250, 365
SfaNI GCATC 1 cut(s) 354
SinI GGWCC 1 cut(s) 339
SmiMI CAYNNNNRTG 1 cut(s) 296
Sse9I AATT 1 cut(s) 315
SsiI CCGC 2 cut(s) 189, 212
SspI AATATT 1 cut(s) 27
SspMI CTAG 1 cut(s) 38
StyD4I CCNGG 4 cut(s) 90, 123, 137, 259
TaqI TCGA 1 cut(s) 101
TasI AATT 1 cut(s) 315
TauI GCSGC 2 cut(s) 191, 215
Tru1I TTAA 1 cut(s) 318
Tru9I TTAA 1 cut(s) 318
TseI GCWGC 3 cut(s) 61, 132, 209
TspDTI ATGAA 2 cut(s) 20, 296
VpaK11BI GGWCC 1 cut(s) 339
XspI CTAG 1 cut(s) 38
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.